Incidental Mutation 'R0563:Kif7'
ID46010
Institutional Source Beutler Lab
Gene Symbol Kif7
Ensembl Gene ENSMUSG00000050382
Gene Namekinesin family member 7
Synonyms
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score130
Status Validated
Chromosome7
Chromosomal Location79698098-79715720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79702272 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 914 (E914G)
Ref Sequence ENSEMBL: ENSMUSP00000139224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206622]
Predicted Effect probably benign
Transcript: ENSMUST00000035977
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
AA Change: E914G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382
AA Change: E914G

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
AA Change: E915G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382
AA Change: E915G

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
AA Change: E915G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382
AA Change: E915G

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
AA Change: E914G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382
AA Change: E914G

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.1220 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cilia-associated protein belonging to the kinesin family. This protein plays a role in the sonic hedgehog (SHH) signaling pathway through the regulation of GLI transcription factors. It functions as a negative regulator of the SHH pathway by preventing inappropriate activation of GLI2 in the absence of ligand, and as a positive regulator by preventing the processing of GLI3 into its repressor form. Mutations in this gene have been associated with various ciliopathies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, exencephaly, polydactyly, abnormal sternum, edema, abnormal ribs, and abnormal neurogenesis. Mice homozygous for an ENU-induced allele exhibit prenatal lethality, polydactyly, and abnormal neural tube development and neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Kif7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Kif7 APN 7 79702278 missense probably damaging 0.99
IGL01551:Kif7 APN 7 79710566 critical splice acceptor site probably null
IGL01897:Kif7 APN 7 79701052 missense probably damaging 0.97
IGL02541:Kif7 APN 7 79710880 missense possibly damaging 0.46
IGL02873:Kif7 APN 7 79706759 missense probably damaging 1.00
IGL03409:Kif7 APN 7 79707553 missense probably benign 0.04
PIT4131001:Kif7 UTSW 7 79711069 missense probably damaging 1.00
R0053:Kif7 UTSW 7 79702179 missense probably benign
R0243:Kif7 UTSW 7 79699560 missense possibly damaging 0.66
R0280:Kif7 UTSW 7 79698823 missense probably benign
R0492:Kif7 UTSW 7 79713881 missense probably damaging 1.00
R1557:Kif7 UTSW 7 79714157 start codon destroyed probably null 0.01
R1637:Kif7 UTSW 7 79702837 missense probably damaging 1.00
R1889:Kif7 UTSW 7 79710463 missense probably damaging 1.00
R1934:Kif7 UTSW 7 79711538 missense probably benign 0.03
R1988:Kif7 UTSW 7 79699241 missense probably benign
R2259:Kif7 UTSW 7 79711589 missense probably damaging 1.00
R2418:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2419:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2511:Kif7 UTSW 7 79702264 missense probably damaging 1.00
R2975:Kif7 UTSW 7 79710260 missense probably damaging 1.00
R3711:Kif7 UTSW 7 79710892 missense probably benign 0.40
R3813:Kif7 UTSW 7 79713890 missense probably damaging 1.00
R4258:Kif7 UTSW 7 79710513 nonsense probably null
R4543:Kif7 UTSW 7 79707548 missense probably benign 0.03
R4648:Kif7 UTSW 7 79709191 missense probably damaging 1.00
R5650:Kif7 UTSW 7 79710979 missense probably damaging 1.00
R5941:Kif7 UTSW 7 79711132 intron probably benign
R6025:Kif7 UTSW 7 79704640 missense probably benign 0.34
R6056:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
R6245:Kif7 UTSW 7 79702143 missense probably damaging 1.00
R6392:Kif7 UTSW 7 79702186 missense probably damaging 1.00
R6464:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
R7513:Kif7 UTSW 7 79711028 missense possibly damaging 0.65
R7728:Kif7 UTSW 7 79710730 missense possibly damaging 0.80
X0063:Kif7 UTSW 7 79702278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTGCCCATGCCCCATACATTAG -3'
(R):5'- GACAGAAGAGATTGCAGCCTTCCAG -3'

Sequencing Primer
(F):5'- AGGGCAAAGTTTCCTGTCTTAC -3'
(R):5'- AGTGGCAGCAATGGCTCTG -3'
Posted On2013-06-11