Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Col6a4'

460100

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

044124-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106063044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1229 (E1229G)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

AlphaFold

A2AX52

Predicted Effect

probably benign
Transcript: ENSMUST00000121963
AA Change: E1229G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: E1229G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankib1	T	C	5: 3,769,633	I95M	possibly damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Kif27	C	T	13: 58,343,970	A452T	probably benign	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Paip1	C	T	13: 119,445,790	T268I	probably damaging	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Rims1	A	T	1: 22,468,241	D609E	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Sox12	T	C	2: 152,397,388	Y104C	probably damaging	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8157:Col6a4	UTSW	9	106067898	missense	possibly damaging	0.92
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
R8832:Col6a4	UTSW	9	106072154	missense	probably benign
R9001:Col6a4	UTSW	9	106067171	missense	probably benign	0.26
R9009:Col6a4	UTSW	9	106077205	missense	probably benign	0.38
R9069:Col6a4	UTSW	9	106074939	missense	possibly damaging	0.85
R9155:Col6a4	UTSW	9	106075010	missense	probably benign
R9175:Col6a4	UTSW	9	106080361	missense	probably benign
R9176:Col6a4	UTSW	9	106061556	missense	probably damaging	1.00
R9295:Col6a4	UTSW	9	106080535	missense	probably damaging	1.00
R9298:Col6a4	UTSW	9	106068335	missense	probably damaging	0.96
R9389:Col6a4	UTSW	9	106000784	missense	probably damaging	1.00
R9424:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
R9576:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTTTACAGAACCCTGATGCAC -3'
(R):5'- GCACAGCAAGGTGTACTTTG -3'

Sequencing Primer
(F):5'- CTGATGCACCAAGAACTTCTGGATG -3'
(R):5'- GCACAGCAAGGTGTACTTTGTATCAG -3'

Posted On

2017-02-28