Incidental Mutation 'R5929:Wrnip1'
ID460111
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene NameWerner helicase interacting protein 1
Synonyms4833444L21Rik, WHIP
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location32802038-32822609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 32806966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 403 (D403H)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
Predicted Effect probably damaging
Transcript: ENSMUST00000021832
AA Change: D403H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: D403H

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057911
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect unknown
Transcript: ENSMUST00000229351
AA Change: D6H
Meta Mutation Damage Score 0.1496 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 32816329 missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32806874 missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 32822070 missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 32820297 missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32806864 missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 32821906 missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32806813 missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 32821090 missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32805379 missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32805336 critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 32820240 missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32802427 missense probably benign
R2475:Wrnip1 UTSW 13 32806958 missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32802761 missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32806883 missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32802347 missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 32816312 missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 32816336 missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32806856 missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32802756 missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32802749 missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32802633 missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 32816281 missense probably benign 0.33
R7468:Wrnip1 UTSW 13 32816377 missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 32816327 nonsense probably null
R8049:Wrnip1 UTSW 13 32821977 missense probably benign
R8260:Wrnip1 UTSW 13 32805356 missense possibly damaging 0.80
X0019:Wrnip1 UTSW 13 32806766 missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32802724 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGTGGCTCTTGAGTGGAATC -3'
(R):5'- AGCTTCCTTACAGGCAGACC -3'

Sequencing Primer
(F):5'- TCCTCCCATGGTTAGGACAC -3'
(R):5'- TTCCTTACAGGCAGACCAATGG -3'
Posted On2017-02-28