Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Kif27'

460114

Institutional Source

Beutler Lab

Gene Symbol

Kif27

Ensembl Gene

ENSMUSG00000060176

Gene Name

kinesin family member 27

Synonyms

4930517I18Rik

MMRRC Submission

044124-MU

Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R5929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58287502-58359122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58343970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 452 (A452T)

Ref Sequence

ENSEMBL: ENSMUSP00000153598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]

AlphaFold

Q7M6Z4

Predicted Effect

probably benign
Transcript: ENSMUST00000043605
AA Change: A452T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: A452T

Domain	Start	End	E-Value	Type
KISc	3	349	9.18e-160	SMART
low complexity region	369	385	N/A	INTRINSIC
coiled coil region	386	418	N/A	INTRINSIC
Blast:KISc	486	566	5e-29	BLAST
coiled coil region	710	790	N/A	INTRINSIC
coiled coil region	835	891	N/A	INTRINSIC
coiled coil region	916	972	N/A	INTRINSIC
low complexity region	993	1008	N/A	INTRINSIC
coiled coil region	1010	1078	N/A	INTRINSIC
coiled coil region	1186	1226	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224694

Predicted Effect

probably benign
Transcript: ENSMUST00000225388
AA Change: A452T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Meta Mutation Damage Score

0.1456

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

MGI Phenotype

Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankib1	T	C	5: 3,769,633	I95M	possibly damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Col6a4	T	C	9: 106,063,044	E1229G	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Paip1	C	T	13: 119,445,790	T268I	probably damaging	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Rims1	A	T	1: 22,468,241	D609E	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Sox12	T	C	2: 152,397,388	Y104C	probably damaging	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Kif27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Kif27	APN	13	58337604	missense	probably benign
IGL00421:Kif27	APN	13	58343889	missense	probably damaging	1.00
IGL00903:Kif27	APN	13	58344672	missense	possibly damaging	0.69
IGL01024:Kif27	APN	13	58288201	missense	possibly damaging	0.71
IGL01070:Kif27	APN	13	58344093	missense	probably damaging	1.00
IGL01761:Kif27	APN	13	58337645	missense	probably benign
IGL02160:Kif27	APN	13	58325998	missense	probably damaging	1.00
IGL03162:Kif27	APN	13	58311207	missense	probably benign	0.03
P0016:Kif27	UTSW	13	58303452	nonsense	probably null
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0481:Kif27	UTSW	13	58311264	splice site	probably benign
R0960:Kif27	UTSW	13	58323967	missense	probably damaging	0.99
R1015:Kif27	UTSW	13	58320215	missense	probably damaging	1.00
R1205:Kif27	UTSW	13	58344205	missense	probably benign	0.00
R1478:Kif27	UTSW	13	58303545	missense	probably damaging	0.98
R1789:Kif27	UTSW	13	58344008	missense	probably damaging	1.00
R1959:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R1961:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R3508:Kif27	UTSW	13	58313212	missense	possibly damaging	0.88
R4168:Kif27	UTSW	13	58345748	missense	probably benign	0.01
R4247:Kif27	UTSW	13	58287917	missense	probably damaging	0.98
R4307:Kif27	UTSW	13	58344123	missense	probably benign	0.00
R4621:Kif27	UTSW	13	58331013	missense	probably benign	0.13
R4660:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4661:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4736:Kif27	UTSW	13	58328971	missense	probably benign	0.04
R4770:Kif27	UTSW	13	58344377	missense	probably damaging	1.00
R4853:Kif27	UTSW	13	58311258	missense	probably benign	0.06
R4963:Kif27	UTSW	13	58328994	missense	possibly damaging	0.85
R4998:Kif27	UTSW	13	58293143	missense	probably damaging	0.98
R5134:Kif27	UTSW	13	58291090	missense	possibly damaging	0.80
R5225:Kif27	UTSW	13	58293101	missense	possibly damaging	0.88
R5835:Kif27	UTSW	13	58313146	critical splice donor site	probably null
R5875:Kif27	UTSW	13	58311104	missense	probably benign	0.01
R6175:Kif27	UTSW	13	58311237	missense	probably damaging	1.00
R6446:Kif27	UTSW	13	58345716	missense	probably damaging	1.00
R6628:Kif27	UTSW	13	58354797	missense	probably damaging	1.00
R7480:Kif27	UTSW	13	58288211	missense	probably benign	0.34
R8381:Kif27	UTSW	13	58291177	missense	probably benign	0.00
R8815:Kif27	UTSW	13	58329004	missense	probably damaging	0.97
R8993:Kif27	UTSW	13	58326098	missense	possibly damaging	0.93
R9181:Kif27	UTSW	13	58344729	missense	probably damaging	1.00
R9486:Kif27	UTSW	13	58344534	missense	probably damaging	1.00
Z1088:Kif27	UTSW	13	58288033	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCCTTAAACAAGTCCTATCTGTG -3'
(R):5'- TCTCTGGAGGAACAGGTAGCTC -3'

Sequencing Primer
(F):5'- TCCCATTGTCAACAGAGTGG -3'
(R):5'- TCAGCTCCAGGAGGAATGTCTG -3'

Posted On

2017-02-28