Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Paip1'

460115

Institutional Source

Beutler Lab

Gene Symbol

Paip1

Ensembl Gene

ENSMUSG00000025451

Gene Name

polyadenylate binding protein-interacting protein 1

Synonyms

MMRRC Submission

044124-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R5929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119428601-119458218 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119445790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 268 (T268I)

Ref Sequence

ENSEMBL: ENSMUSP00000117256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627] [ENSMUST00000174533]

AlphaFold

Q8VE62

Predicted Effect

probably damaging
Transcript: ENSMUST00000026520
AA Change: T184I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451
AA Change: T184I

Domain	Start	End	E-Value	Type
Pfam:PAM2	44	61	8.9e-8	PFAM
MIF4G	80	297	2.62e-46	SMART
low complexity region	373	385	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109203
AA Change: T151I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451
AA Change: T151I

Domain	Start	End	E-Value	Type
Pfam:PAM2	11	28	3.7e-7	PFAM
MIF4G	47	264	2.62e-46	SMART
low complexity region	340	352	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000126957
AA Change: T268I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451
AA Change: T268I

Domain	Start	End	E-Value	Type
low complexity region	7	38	N/A	INTRINSIC
low complexity region	44	74	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
Pfam:PAM2	128	145	3.3e-7	PFAM
MIF4G	164	381	2.62e-46	SMART
low complexity region	457	469	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132304

SMART Domains

Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451

Domain	Start	End	E-Value	Type
low complexity region	7	38	N/A	INTRINSIC
low complexity region	44	74	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
Pfam:PAM2	128	145	6.8e-5	PFAM
Pfam:MIF4G	164	267	1.9e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173339

Predicted Effect

probably damaging
Transcript: ENSMUST00000173627
AA Change: T184I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451
AA Change: T184I

Domain	Start	End	E-Value	Type
Pfam:PAM2	44	61	3.6e-7	PFAM
MIF4G	80	297	2.62e-46	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174533
AA Change: T20I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134365
Gene: ENSMUSG00000025451
AA Change: T20I

Domain	Start	End	E-Value	Type
Pfam:MIF4G	49	106	1.4e-8	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000174691
AA Change: T175I

SMART Domains

Protein: ENSMUSP00000134502
Gene: ENSMUSG00000025451
AA Change: T175I

Domain	Start	End	E-Value	Type
Pfam:PAM2	36	53	2.4e-7	PFAM
Pfam:MIF4G	72	207	1.6e-27	PFAM

Meta Mutation Damage Score

0.2894

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankib1	T	C	5: 3,769,633	I95M	possibly damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Col6a4	T	C	9: 106,063,044	E1229G	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Kif27	C	T	13: 58,343,970	A452T	probably benign	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Rims1	A	T	1: 22,468,241	D609E	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Sox12	T	C	2: 152,397,388	Y104C	probably damaging	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Paip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02668:Paip1	APN	13	119438071	missense	probably damaging	1.00
IGL02873:Paip1	APN	13	119445812	missense	possibly damaging	0.95
R0517:Paip1	UTSW	13	119447790	missense	probably damaging	1.00
R0791:Paip1	UTSW	13	119430318	missense	possibly damaging	0.69
R0792:Paip1	UTSW	13	119430318	missense	possibly damaging	0.69
R1419:Paip1	UTSW	13	119457017	missense	probably damaging	0.99
R1572:Paip1	UTSW	13	119451784	unclassified	probably benign
R1935:Paip1	UTSW	13	119457014	missense	probably damaging	1.00
R1936:Paip1	UTSW	13	119457014	missense	probably damaging	1.00
R2072:Paip1	UTSW	13	119430262	missense	possibly damaging	0.88
R3827:Paip1	UTSW	13	119430232	start codon destroyed	probably null	0.47
R4082:Paip1	UTSW	13	119457004	missense	probably damaging	1.00
R4092:Paip1	UTSW	13	119449913	missense	probably benign	0.02
R4854:Paip1	UTSW	13	119449889	splice site	probably benign
R5012:Paip1	UTSW	13	119447802	missense	probably benign
R5103:Paip1	UTSW	13	119437979	missense	possibly damaging	0.95
R5425:Paip1	UTSW	13	119430166	missense	possibly damaging	0.60
R5592:Paip1	UTSW	13	119450798	missense	probably damaging	1.00
R5851:Paip1	UTSW	13	119440765	missense	possibly damaging	0.94
R5976:Paip1	UTSW	13	119456997	missense	probably damaging	1.00
R6021:Paip1	UTSW	13	119457135	frame shift	probably null
R6326:Paip1	UTSW	13	119430217	missense	probably benign	0.00
R6964:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7544:Paip1	UTSW	13	119445801	missense	probably damaging	1.00
R7552:Paip1	UTSW	13	119440820	missense	possibly damaging	0.83
R7659:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7660:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7661:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7984:Paip1	UTSW	13	119430162	nonsense	probably null
R8294:Paip1	UTSW	13	119450764	missense	possibly damaging	0.95
R8884:Paip1	UTSW	13	119438017	missense	probably damaging	1.00
R8888:Paip1	UTSW	13	119430265	missense	probably benign	0.02
R8895:Paip1	UTSW	13	119430265	missense	probably benign	0.02
R9315:Paip1	UTSW	13	119449980	missense	probably benign	0.24
Z1177:Paip1	UTSW	13	119447808	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TTCTTAAAACTGCAGCCTTTGG -3'
(R):5'- GATTGCAGGCAGTTATCACCTG -3'

Sequencing Primer
(F):5'- GCAGCCTTTGGAGAGGTTAG -3'
(R):5'- AGGCAGTTATCACCTGGCATC -3'

Posted On

2017-02-28