Incidental Mutation 'R5929:Hacl1'
ID460116
Institutional Source Beutler Lab
Gene Symbol Hacl1
Ensembl Gene ENSMUSG00000021884
Gene Name2-hydroxyacyl-CoA lyase 1
SynonymsHpcl, Phyh2
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31598730-31641286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31616388 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 411 (M411L)
Ref Sequence ENSEMBL: ENSMUSP00000114922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022437] [ENSMUST00000127204] [ENSMUST00000156431] [ENSMUST00000165955] [ENSMUST00000167066] [ENSMUST00000167175] [ENSMUST00000171414]
Predicted Effect probably benign
Transcript: ENSMUST00000022437
AA Change: M411L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022437
Gene: ENSMUSG00000021884
AA Change: M411L

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 185 6.1e-46 PFAM
Pfam:TPP_enzyme_M 206 335 1.9e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127204
AA Change: M384L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120452
Gene: ENSMUSG00000021884
AA Change: M384L

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 81 1.3e-14 PFAM
Pfam:TPP_enzyme_N 75 159 3.3e-14 PFAM
Pfam:TPP_enzyme_M 179 310 1.5e-34 PFAM
Pfam:TPP_enzyme_C 373 533 7.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140078
Predicted Effect probably benign
Transcript: ENSMUST00000156431
AA Change: M411L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114922
Gene: ENSMUSG00000021884
AA Change: M411L

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 186 3.3e-46 PFAM
Pfam:TPP_enzyme_M 206 337 2.1e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165955
SMART Domains Protein: ENSMUSP00000129090
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 105 3.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167066
AA Change: M351L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000132913
Gene: ENSMUSG00000021884
AA Change: M351L

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 131 2.5e-33 PFAM
Pfam:TPP_enzyme_M 180 311 4.7e-34 PFAM
Pfam:TPP_enzyme_C 340 500 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167175
SMART Domains Protein: ENSMUSP00000128588
Gene: ENSMUSG00000115022

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 139 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171414
SMART Domains Protein: ENSMUSP00000130268
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 109 1.3e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Hacl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Hacl1 APN 14 31626417 missense probably benign 0.04
IGL01548:Hacl1 APN 14 31640596 missense possibly damaging 0.78
IGL01952:Hacl1 APN 14 31641122 unclassified probably benign
IGL02059:Hacl1 APN 14 31632934 missense probably benign 0.00
IGL02138:Hacl1 APN 14 31630983 missense probably benign 0.05
IGL02637:Hacl1 APN 14 31640501 missense probably damaging 1.00
IGL03235:Hacl1 APN 14 31631038 nonsense probably null
R0502:Hacl1 UTSW 14 31622984 splice site probably benign
R1697:Hacl1 UTSW 14 31621000 splice site probably null
R1800:Hacl1 UTSW 14 31614264 missense probably damaging 1.00
R1829:Hacl1 UTSW 14 31640534 missense probably benign 0.00
R3937:Hacl1 UTSW 14 31634191 splice site probably benign
R3938:Hacl1 UTSW 14 31634191 splice site probably benign
R5004:Hacl1 UTSW 14 31619039 missense probably benign
R5776:Hacl1 UTSW 14 31622871 missense possibly damaging 0.90
R5868:Hacl1 UTSW 14 31619916 missense probably damaging 1.00
R6261:Hacl1 UTSW 14 31635771 missense probably damaging 1.00
R6996:Hacl1 UTSW 14 31615423 missense possibly damaging 0.96
R7298:Hacl1 UTSW 14 31616486 missense probably damaging 1.00
R7768:Hacl1 UTSW 14 31616480 missense probably damaging 1.00
R7887:Hacl1 UTSW 14 31634227 missense probably damaging 1.00
R7970:Hacl1 UTSW 14 31634227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGCAGACATGTGGTAC -3'
(R):5'- TGTCACAGTAACTTTCATGATGTCCC -3'

Sequencing Primer
(F):5'- TGGTACACATACATACACACAGG -3'
(R):5'- GGAACTGGCTTCCCAAAA -3'
Posted On2017-02-28