Incidental Mutation 'R0563:Pnpla6'
ID46012
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3523333 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 399 (D399G)
Ref Sequence ENSEMBL: ENSMUSP00000146680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208762]
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: D377G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: D377G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: D377G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: D377G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207430
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: D409G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208002
AA Change: D399G

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208006
Predicted Effect probably benign
Transcript: ENSMUST00000208762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7426:Pnpla6 UTSW 8 3516540 utr 5 prime probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3536594 missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3531677 missense probably benign 0.38
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Z1177:Pnpla6 UTSW 8 3536979 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGGCAACTTGAAGTTCTCTGTCCC -3'
(R):5'- AGACATGACTAGCCAATGACTGCAC -3'

Sequencing Primer
(F):5'- GAACTCGGTCAGCATATTTACTCG -3'
(R):5'- CTGCATCTTAACACAGTTGGGAG -3'
Posted On2013-06-11