Incidental Mutation 'R5929:Dcaf13'
ID460122
Institutional Source Beutler Lab
Gene Symbol Dcaf13
Ensembl Gene ENSMUSG00000022300
Gene NameDDB1 and CUL4 associated factor 13
SynonymsLOC223499, Wdsof1
MMRRC Submission 044124-MU
Accession Numbers

Genbank: NM_198606; MGI: 2684929

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39112865-39146856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39143653 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 327 (H327Q)
Ref Sequence ENSEMBL: ENSMUSP00000022909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022909
AA Change: H327Q

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: H327Q

DomainStartEndE-ValueType
WD40 55 95 5.77e-5 SMART
WD40 98 137 4.38e-5 SMART
WD40 185 225 5.97e-1 SMART
Blast:WD40 228 267 1e-18 BLAST
WD40 271 310 2.69e-5 SMART
WD40 312 353 2.96e-2 SMART
Pfam:Sof1 354 440 7.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227219
Meta Mutation Damage Score 0.1791 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Dcaf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Dcaf13 APN 15 39143632 nonsense probably null
IGL01081:Dcaf13 APN 15 39118806 missense probably damaging 1.00
IGL01766:Dcaf13 APN 15 39118750 missense probably benign 0.00
IGL02174:Dcaf13 APN 15 39138149 missense probably damaging 1.00
IGL02262:Dcaf13 APN 15 39118707 splice site probably benign
IGL02740:Dcaf13 APN 15 39145100 nonsense probably null
IGL03092:Dcaf13 APN 15 39127976 splice site probably benign
IGL03374:Dcaf13 APN 15 39145148 nonsense probably null
R0590:Dcaf13 UTSW 15 39145085 splice site probably benign
R0594:Dcaf13 UTSW 15 39123268 missense probably benign 0.00
R0711:Dcaf13 UTSW 15 39138089 missense probably damaging 1.00
R1036:Dcaf13 UTSW 15 39143718 missense probably damaging 1.00
R1770:Dcaf13 UTSW 15 39130238 missense probably damaging 1.00
R1826:Dcaf13 UTSW 15 39118899 missense probably damaging 1.00
R1933:Dcaf13 UTSW 15 39138088 missense probably damaging 0.99
R2508:Dcaf13 UTSW 15 39145152 missense probably benign
R4113:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
R4595:Dcaf13 UTSW 15 39118893 missense probably damaging 1.00
R4649:Dcaf13 UTSW 15 39138242 missense possibly damaging 0.54
R5431:Dcaf13 UTSW 15 39123224 missense probably benign 0.16
R5454:Dcaf13 UTSW 15 39124364 missense probably benign
R5834:Dcaf13 UTSW 15 39143642 nonsense probably null
R5944:Dcaf13 UTSW 15 39146677 missense probably benign
R6319:Dcaf13 UTSW 15 39143672 missense probably benign 0.00
R6394:Dcaf13 UTSW 15 39143737 missense probably benign 0.04
R6664:Dcaf13 UTSW 15 39118888 missense probably damaging 1.00
R6884:Dcaf13 UTSW 15 39123240 missense probably damaging 1.00
R7419:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
Z1088:Dcaf13 UTSW 15 39145247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTCTGTTAGGCCATCTGTCTG -3'
(R):5'- CCATCACAATGGTGTTACCCTG -3'

Sequencing Primer
(F):5'- TTCCCAAGCACTTAGACTAGAAC -3'
(R):5'- CACAATGGTGTTACCCTGATTAAG -3'
Posted On2017-02-28