Incidental Mutation 'R5929:Lhcgr'
ID460125
Institutional Source Beutler Lab
Gene Symbol Lhcgr
Ensembl Gene ENSMUSG00000024107
Gene Nameluteinizing hormone/choriogonadotropin receptor
SynonymsLhr, LH-R, Gpcr19-rs1
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location88741549-88791976 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88743008 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 363 (Y363*)
Ref Sequence ENSEMBL: ENSMUSP00000024916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024916]
Predicted Effect probably null
Transcript: ENSMUST00000024916
AA Change: Y363*
SMART Domains Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: Y363*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 33 66 4.4e0 SMART
Pfam:LRR_5 155 273 2.9e-5 PFAM
Pfam:7tm_1 380 627 1.2e-29 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Lhcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lhcgr APN 17 88742446 missense probably benign
IGL00661:Lhcgr APN 17 88750118 missense probably benign
IGL00840:Lhcgr APN 17 88753736 splice site probably benign
IGL01434:Lhcgr APN 17 88742437 missense probably damaging 1.00
IGL01489:Lhcgr APN 17 88764973 splice site probably benign
IGL02077:Lhcgr APN 17 88750130 missense probably benign 0.06
IGL02533:Lhcgr APN 17 88742410 missense probably benign 0.00
IGL02948:Lhcgr APN 17 88742622 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0556:Lhcgr UTSW 17 88772063 missense probably damaging 0.99
R1824:Lhcgr UTSW 17 88750157 missense probably benign 0.00
R1846:Lhcgr UTSW 17 88765147 critical splice donor site probably null
R1852:Lhcgr UTSW 17 88765176 missense probably damaging 0.99
R2352:Lhcgr UTSW 17 88742299 missense possibly damaging 0.52
R3147:Lhcgr UTSW 17 88758343 missense probably damaging 0.96
R3756:Lhcgr UTSW 17 88753856 missense possibly damaging 0.77
R4180:Lhcgr UTSW 17 88742283 missense probably damaging 1.00
R4540:Lhcgr UTSW 17 88755608 missense probably benign
R4688:Lhcgr UTSW 17 88765152 missense probably damaging 0.99
R4717:Lhcgr UTSW 17 88742467 missense probably benign 0.00
R4723:Lhcgr UTSW 17 88742602 missense probably benign 0.09
R4776:Lhcgr UTSW 17 88742697 missense probably damaging 1.00
R4903:Lhcgr UTSW 17 88742361 missense probably damaging 1.00
R5195:Lhcgr UTSW 17 88742946 missense probably damaging 1.00
R5231:Lhcgr UTSW 17 88755611 missense probably damaging 1.00
R5361:Lhcgr UTSW 17 88742853 missense probably damaging 1.00
R5683:Lhcgr UTSW 17 88772019 missense probably benign 0.00
R5758:Lhcgr UTSW 17 88742548 missense probably damaging 0.99
R5987:Lhcgr UTSW 17 88755578 missense probably damaging 1.00
R6268:Lhcgr UTSW 17 88742704 missense probably damaging 1.00
R6477:Lhcgr UTSW 17 88742373 missense probably damaging 1.00
R6610:Lhcgr UTSW 17 88769879 missense possibly damaging 0.93
R7234:Lhcgr UTSW 17 88791931 missense possibly damaging 0.96
R7282:Lhcgr UTSW 17 88758383 missense probably benign
R7320:Lhcgr UTSW 17 88742078 missense probably benign
R7398:Lhcgr UTSW 17 88772046 missense probably benign 0.03
R7710:Lhcgr UTSW 17 88742782 missense probably damaging 1.00
R8034:Lhcgr UTSW 17 88742356 missense probably damaging 1.00
U24488:Lhcgr UTSW 17 88772085 critical splice acceptor site probably null
X0028:Lhcgr UTSW 17 88742722 missense probably damaging 1.00
Z1176:Lhcgr UTSW 17 88742270 missense probably damaging 1.00
Z1177:Lhcgr UTSW 17 88753905 missense probably benign 0.00
Z1177:Lhcgr UTSW 17 88764981 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTAAAGAAGCCAGCTGCACTG -3'
(R):5'- GGGAACCGTTTCTGTTTCCC -3'

Sequencing Primer
(F):5'- CCAGTCTATGGCATGGTTATAGTAC -3'
(R):5'- CTCAAGCCAATGTTTGTCTTGCAG -3'
Posted On2017-02-28