Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Hdac3'

460127

Institutional Source

Beutler Lab

Gene Symbol

Hdac3

Ensembl Gene

ENSMUSG00000024454

Gene Name

histone deacetylase 3

Synonyms

MMRRC Submission

044124-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37935844-37954988 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 37941341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000037981 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043498]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043498

SMART Domains

Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

Domain	Start	End	E-Value	Type
Pfam:Hist_deacetyl	11	315	1.2e-82	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153945

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene results in embryonic death at or around the time of gastrulation. Structural and functional abnormalities are also reported in mitochondria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankib1	T	C	5: 3,769,633	I95M	possibly damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Col6a4	T	C	9: 106,063,044	E1229G	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Kif27	C	T	13: 58,343,970	A452T	probably benign	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Paip1	C	T	13: 119,445,790	T268I	probably damaging	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Rims1	A	T	1: 22,468,241	D609E	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Sox12	T	C	2: 152,397,388	Y104C	probably damaging	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Hdac3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Hdac3	APN	18	37954885	missense	possibly damaging	0.95
IGL00570:Hdac3	APN	18	37944121	splice site	probably benign
IGL01511:Hdac3	APN	18	37952595	missense	probably benign	0.16
IGL01559:Hdac3	APN	18	37943672	splice site	probably benign
IGL01688:Hdac3	APN	18	37954879	missense	possibly damaging	0.53
IGL02529:Hdac3	APN	18	37944132	missense	probably benign	0.20
IGL02559:Hdac3	APN	18	37954891	missense	probably damaging	1.00
IGL02702:Hdac3	APN	18	37941094	missense	probably benign	0.00
PIT4520001:Hdac3	UTSW	18	37941764	missense	probably damaging	1.00
R0173:Hdac3	UTSW	18	37941753	missense	probably damaging	0.97
R0325:Hdac3	UTSW	18	37940952	critical splice donor site	probably null
R0445:Hdac3	UTSW	18	37943724	missense	probably damaging	0.99
R1341:Hdac3	UTSW	18	37954713	missense	probably damaging	1.00
R2068:Hdac3	UTSW	18	37943516	missense	probably damaging	1.00
R2761:Hdac3	UTSW	18	37945726	missense	probably benign	0.19
R3805:Hdac3	UTSW	18	37945692	critical splice donor site	probably null
R4467:Hdac3	UTSW	18	37952513	missense	probably benign	0.03
R5928:Hdac3	UTSW	18	37941341	intron	probably benign
R6341:Hdac3	UTSW	18	37944164	missense	probably damaging	0.99
R6679:Hdac3	UTSW	18	37944933	missense	possibly damaging	0.59
R6843:Hdac3	UTSW	18	37941954	missense	probably benign
R7262:Hdac3	UTSW	18	37945563	missense	probably damaging	0.99
R7559:Hdac3	UTSW	18	37945516	missense	possibly damaging	0.94
R7585:Hdac3	UTSW	18	37945355	missense	probably damaging	1.00
R7652:Hdac3	UTSW	18	37954919	unclassified	probably benign
R8434:Hdac3	UTSW	18	37941422	missense	possibly damaging	0.68
R9400:Hdac3	UTSW	18	37937624	missense	possibly damaging	0.71
Z1177:Hdac3	UTSW	18	37945751	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGATTGTCTGGCGGATCTG -3'
(R):5'- ACTCTGGTGTCTCAGCCATAC -3'

Sequencing Primer
(F):5'- TCTGGTCCAGATACTAGTTTAGAAG -3'
(R):5'- GGTGTCTCAGCCATACTCTTG -3'

Posted On

2017-02-28