Incidental Mutation 'R5929:Tlr7'
ID460132
Institutional Source Beutler Lab
Gene Symbol Tlr7
Ensembl Gene ENSMUSG00000044583
Gene Nametoll-like receptor 7
SynonymsRP23-139P21.3
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5929 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location167304929-167330558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 167306882 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 536 (G536V)
Ref Sequence ENSEMBL: ENSMUSP00000107789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060719] [ENSMUST00000112161] [ENSMUST00000112164] [ENSMUST00000137492] [ENSMUST00000145284]
Predicted Effect probably damaging
Transcript: ENSMUST00000060719
AA Change: G536V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061853
Gene: ENSMUSG00000044583
AA Change: G536V

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112161
AA Change: G536V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107787
Gene: ENSMUSG00000044583
AA Change: G536V

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
Pfam:LRR_7 676 692 7.2e-2 PFAM
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112164
AA Change: G536V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107789
Gene: ENSMUSG00000044583
AA Change: G536V

DomainStartEndE-ValueType
LRRNT 35 69 5.03e-1 SMART
LRR 126 149 2.45e0 SMART
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
LRR 396 419 9.22e0 SMART
LRR 497 516 1.09e2 SMART
LRR 542 565 4.97e0 SMART
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 891 1049 1.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137492
Predicted Effect probably benign
Transcript: ENSMUST00000145284
Meta Mutation Damage Score 0.9224 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Tlr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Tlr7 APN X 167308475 missense possibly damaging 0.94
IGL01064:Tlr7 APN X 167308211 missense probably damaging 1.00
IGL02940:Tlr7 APN X 167307834 missense probably benign 0.02
IGL03064:Tlr7 APN X 167306207 missense possibly damaging 0.89
IGL03298:Tlr7 APN X 167306707 missense probably benign 0.45
rsq1 UTSW X 167308286 missense probably damaging 1.00
rsq2 UTSW X 167307945 missense probably damaging 1.00
rsq3 UTSW X 167307945 missense probably damaging 1.00
R1400:Tlr7 UTSW X 167307849 missense probably damaging 1.00
R1883:Tlr7 UTSW X 167306472 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATGAGTTTGTCCAGAAGCCG -3'
(R):5'- AATATGCACGGAGCTGCAG -3'

Sequencing Primer
(F):5'- CCAGAAGCCGTAATTTCTTGG -3'
(R):5'- CGGAGCTGCAGGTTCAAAAAC -3'
Posted On2017-02-28