Incidental Mutation 'R5930:Fer1l5'
ID460133
Institutional Source Beutler Lab
Gene Symbol Fer1l5
Ensembl Gene ENSMUSG00000037432
Gene Namefer-1-like 5 (C. elegans)
Synonyms
MMRRC Submission 044125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5930 (G1)
Quality Score188
Status Validated
Chromosome1
Chromosomal Location36372291-36422110 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36385173 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 289 (C289*)
Ref Sequence ENSEMBL: ENSMUSP00000142130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179162]
Predicted Effect probably null
Transcript: ENSMUST00000179162
AA Change: C289*
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432
AA Change: C289*

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202030
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,397,451 V5572I probably benign Het
AF366264 T A 8: 13,837,263 D276V probably benign Het
Agap1 C T 1: 89,843,096 T656I probably damaging Het
Als2cl C T 9: 110,887,364 R247W probably damaging Het
Ankfy1 A T 11: 72,712,245 R33S probably benign Het
Ano5 T C 7: 51,585,331 F671L probably damaging Het
Arhgap26 A G 18: 39,150,092 M361V probably damaging Het
Bckdk A G 7: 127,905,973 E175G probably damaging Het
Bptf G T 11: 107,073,196 T1724K probably damaging Het
Btn2a2 T A 13: 23,486,228 I112F probably damaging Het
Cd163l1 C T 7: 140,230,446 P984S probably benign Het
Cln8 T A 8: 14,896,621 W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 E300G probably benign Het
Cnksr3 T C 10: 7,142,993 I173V probably benign Het
Cntn2 T A 1: 132,523,432 D484V probably damaging Het
Cyp4a14 C A 4: 115,491,410 G319V probably damaging Het
Cyp4f37 G A 17: 32,629,983 R275Q possibly damaging Het
Def8 C T 8: 123,460,070 probably benign Het
Dnah10 T C 5: 124,791,791 probably null Het
Dock6 A G 9: 21,824,416 V1012A probably benign Het
Dus3l T A 17: 56,769,579 N586K probably damaging Het
Dyrk2 T A 10: 118,860,268 I362F probably damaging Het
Dyx1c1 T C 9: 72,971,998 V356A probably damaging Het
Erc2 T A 14: 27,776,858 D230E probably damaging Het
Fam102b A T 3: 108,980,152 S265R probably benign Het
Fat1 A G 8: 45,044,036 H4186R probably benign Het
Fbxo44 A G 4: 148,156,595 F179S probably damaging Het
Fech A G 18: 64,478,649 probably null Het
Fhl5 T A 4: 25,214,756 D7V probably benign Het
Flvcr1 G T 1: 191,009,551 T514K probably damaging Het
Fmo1 A T 1: 162,839,616 probably null Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gli3 A G 13: 15,548,625 Y117C probably damaging Het
Gnao1 A G 8: 93,896,245 D59G probably benign Het
Gria2 T C 3: 80,707,249 I495V possibly damaging Het
Hnf1b C A 11: 83,863,985 H161Q probably benign Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Itpr3 A T 17: 27,110,921 Q1563L possibly damaging Het
Kctd16 A G 18: 40,530,829 N337S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Krtap4-9 T A 11: 99,785,636 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Mchr1 T C 15: 81,237,843 F265L probably damaging Het
Megf8 T A 7: 25,326,441 Y83* probably null Het
Mettl18 A G 1: 163,997,177 M356V probably null Het
Mrm1 G A 11: 84,819,192 R61W probably damaging Het
Muc4 A T 16: 32,751,705 T528S probably benign Het
Myef2 A T 2: 125,095,731 L530* probably null Het
Nhlrc4 T C 17: 25,943,719 E18G probably benign Het
Nisch C T 14: 31,173,145 V1065I probably benign Het
Nlgn2 C T 11: 69,834,149 R97H probably damaging Het
Nos2 T C 11: 78,937,915 L321S probably damaging Het
Oaz3 T C 3: 94,436,410 M49V possibly damaging Het
Olfm5 A G 7: 104,154,155 V367A probably damaging Het
Olfr130 C A 17: 38,067,750 A193D probably benign Het
Olfr1335 C T 4: 118,809,378 R162H probably benign Het
Olfr564 A T 7: 102,804,274 R265S probably damaging Het
Olfr742 C A 14: 50,515,792 A196D probably benign Het
Olfr77 A G 9: 19,920,910 K234E probably damaging Het
Omd C T 13: 49,589,636 P54L possibly damaging Het
Pard3b T A 1: 61,768,130 probably benign Het
Pcdhb18 A C 18: 37,491,935 I773L possibly damaging Het
Pde11a T C 2: 76,139,831 probably null Het
Pfkfb4 A C 9: 109,030,394 probably benign Het
Phb2 T G 6: 124,715,649 I260S probably damaging Het
Pkd1l1 G A 11: 8,958,969 T345I unknown Het
Pla2g6 T C 15: 79,303,528 probably benign Het
Pou4f2 G A 8: 78,436,391 S5F unknown Het
Ppp1r9a A T 6: 5,157,002 probably null Het
Pramel5 A G 4: 144,272,983 I178T probably benign Het
Prom2 C T 2: 127,530,133 W745* probably null Het
Pros1 T A 16: 62,928,061 N632K probably damaging Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rbm25 T A 12: 83,677,866 H796Q possibly damaging Het
Rnf151 A T 17: 24,718,030 probably null Het
Rps6ka1 A T 4: 133,871,571 L97I probably damaging Het
Sergef T A 7: 46,443,464 T374S probably benign Het
Sh3rf3 G T 10: 59,130,986 G717C probably damaging Het
Slc29a4 C T 5: 142,721,402 T500I possibly damaging Het
Smc1b T A 15: 85,086,121 D977V probably damaging Het
Spata31d1d C T 13: 59,727,015 C902Y probably benign Het
St14 A T 9: 31,103,760 V314D probably damaging Het
Stat3 A T 11: 100,893,670 I602N possibly damaging Het
Stx4a T A 7: 127,846,489 I189N probably damaging Het
Tacc1 A G 8: 25,182,199 S338P probably benign Het
Tcirg1 T A 19: 3,902,424 T315S possibly damaging Het
Tenm4 A T 7: 96,854,719 N1295I probably damaging Het
Tm7sf3 T C 6: 146,603,911 K516E possibly damaging Het
Tmem198b T C 10: 128,801,454 E272G possibly damaging Het
Tnip3 A G 6: 65,605,953 Q237R probably damaging Het
Trim15 C T 17: 36,862,360 probably null Het
Trim30a T A 7: 104,421,450 N252I possibly damaging Het
Ttc39a A G 4: 109,430,878 E227G probably benign Het
Ttll13 A G 7: 80,253,166 E194G probably damaging Het
Upf1 G A 8: 70,344,262 T107I probably benign Het
Vac14 A G 8: 110,710,349 I565V probably damaging Het
Zcchc14 A T 8: 121,611,358 probably benign Het
Other mutations in Fer1l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4151001:Fer1l5 UTSW 1 36411647 missense probably benign 0.27
R5580:Fer1l5 UTSW 1 36385458 nonsense probably null
R5848:Fer1l5 UTSW 1 36388935 missense probably benign 0.39
R6193:Fer1l5 UTSW 1 36409436 missense probably benign 0.20
R6195:Fer1l5 UTSW 1 36375286 splice site probably null
R6207:Fer1l5 UTSW 1 36385160 missense probably damaging 1.00
R6233:Fer1l5 UTSW 1 36375286 splice site probably null
R6349:Fer1l5 UTSW 1 36411274 missense probably damaging 0.96
R6478:Fer1l5 UTSW 1 36402531 missense probably damaging 1.00
R6514:Fer1l5 UTSW 1 36403616 missense probably benign 0.01
R6611:Fer1l5 UTSW 1 36406654 missense probably benign 0.01
R6634:Fer1l5 UTSW 1 36411385 missense probably damaging 0.99
R6733:Fer1l5 UTSW 1 36408672 critical splice donor site probably null
R6816:Fer1l5 UTSW 1 36406510 missense possibly damaging 0.60
R7225:Fer1l5 UTSW 1 36420952 missense possibly damaging 0.90
R7316:Fer1l5 UTSW 1 36418116 missense probably benign 0.41
R7455:Fer1l5 UTSW 1 36388983 missense probably benign 0.00
R7473:Fer1l5 UTSW 1 36421608 missense possibly damaging 0.53
R7702:Fer1l5 UTSW 1 36420694 nonsense probably null
R7714:Fer1l5 UTSW 1 36401477 missense probably damaging 1.00
R7872:Fer1l5 UTSW 1 36421886 missense probably benign 0.00
R7881:Fer1l5 UTSW 1 36407036 missense not run
R7955:Fer1l5 UTSW 1 36421886 missense probably benign 0.00
R7964:Fer1l5 UTSW 1 36407036 missense not run
Z1176:Fer1l5 UTSW 1 36390563 nonsense probably null
Z1177:Fer1l5 UTSW 1 36409194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGCATGTGAGACACCACTTG -3'
(R):5'- CCCGACTTTCCATGTGATGCAG -3'

Sequencing Primer
(F):5'- CCTGTTTTCCCTGGAAACAAAGG -3'
(R):5'- CATGTGATGCAGGGAGAGC -3'
Posted On2017-02-28