Incidental Mutation 'R5930:Pard3b'
ID460134
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Namepar-3 family cell polarity regulator beta
SynonymsPAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
MMRRC Submission 044125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5930 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location61638824-62642284 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 61768130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
Predicted Effect probably benign
Transcript: ENSMUST00000046673
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075374
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094906
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138768
SMART Domains Protein: ENSMUSP00000116912
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 7e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188325
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,397,451 V5572I probably benign Het
AF366264 T A 8: 13,837,263 D276V probably benign Het
Agap1 C T 1: 89,843,096 T656I probably damaging Het
Als2cl C T 9: 110,887,364 R247W probably damaging Het
Ankfy1 A T 11: 72,712,245 R33S probably benign Het
Ano5 T C 7: 51,585,331 F671L probably damaging Het
Arhgap26 A G 18: 39,150,092 M361V probably damaging Het
Bckdk A G 7: 127,905,973 E175G probably damaging Het
Bptf G T 11: 107,073,196 T1724K probably damaging Het
Btn2a2 T A 13: 23,486,228 I112F probably damaging Het
Cd163l1 C T 7: 140,230,446 P984S probably benign Het
Cln8 T A 8: 14,896,621 W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 E300G probably benign Het
Cnksr3 T C 10: 7,142,993 I173V probably benign Het
Cntn2 T A 1: 132,523,432 D484V probably damaging Het
Cyp4a14 C A 4: 115,491,410 G319V probably damaging Het
Cyp4f37 G A 17: 32,629,983 R275Q possibly damaging Het
Def8 C T 8: 123,460,070 probably benign Het
Dnah10 T C 5: 124,791,791 probably null Het
Dock6 A G 9: 21,824,416 V1012A probably benign Het
Dus3l T A 17: 56,769,579 N586K probably damaging Het
Dyrk2 T A 10: 118,860,268 I362F probably damaging Het
Dyx1c1 T C 9: 72,971,998 V356A probably damaging Het
Erc2 T A 14: 27,776,858 D230E probably damaging Het
Fam102b A T 3: 108,980,152 S265R probably benign Het
Fat1 A G 8: 45,044,036 H4186R probably benign Het
Fbxo44 A G 4: 148,156,595 F179S probably damaging Het
Fech A G 18: 64,478,649 probably null Het
Fer1l5 T A 1: 36,385,173 C289* probably null Het
Fhl5 T A 4: 25,214,756 D7V probably benign Het
Flvcr1 G T 1: 191,009,551 T514K probably damaging Het
Fmo1 A T 1: 162,839,616 probably null Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gli3 A G 13: 15,548,625 Y117C probably damaging Het
Gnao1 A G 8: 93,896,245 D59G probably benign Het
Gria2 T C 3: 80,707,249 I495V possibly damaging Het
Hnf1b C A 11: 83,863,985 H161Q probably benign Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Itpr3 A T 17: 27,110,921 Q1563L possibly damaging Het
Kctd16 A G 18: 40,530,829 N337S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Krtap4-9 T A 11: 99,785,636 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Mchr1 T C 15: 81,237,843 F265L probably damaging Het
Megf8 T A 7: 25,326,441 Y83* probably null Het
Mettl18 A G 1: 163,997,177 M356V probably null Het
Mrm1 G A 11: 84,819,192 R61W probably damaging Het
Muc4 A T 16: 32,751,705 T528S probably benign Het
Myef2 A T 2: 125,095,731 L530* probably null Het
Nhlrc4 T C 17: 25,943,719 E18G probably benign Het
Nisch C T 14: 31,173,145 V1065I probably benign Het
Nlgn2 C T 11: 69,834,149 R97H probably damaging Het
Nos2 T C 11: 78,937,915 L321S probably damaging Het
Oaz3 T C 3: 94,436,410 M49V possibly damaging Het
Olfm5 A G 7: 104,154,155 V367A probably damaging Het
Olfr130 C A 17: 38,067,750 A193D probably benign Het
Olfr1335 C T 4: 118,809,378 R162H probably benign Het
Olfr564 A T 7: 102,804,274 R265S probably damaging Het
Olfr742 C A 14: 50,515,792 A196D probably benign Het
Olfr77 A G 9: 19,920,910 K234E probably damaging Het
Omd C T 13: 49,589,636 P54L possibly damaging Het
Pcdhb18 A C 18: 37,491,935 I773L possibly damaging Het
Pde11a T C 2: 76,139,831 probably null Het
Pfkfb4 A C 9: 109,030,394 probably benign Het
Phb2 T G 6: 124,715,649 I260S probably damaging Het
Pkd1l1 G A 11: 8,958,969 T345I unknown Het
Pla2g6 T C 15: 79,303,528 probably benign Het
Pou4f2 G A 8: 78,436,391 S5F unknown Het
Ppp1r9a A T 6: 5,157,002 probably null Het
Pramel5 A G 4: 144,272,983 I178T probably benign Het
Prom2 C T 2: 127,530,133 W745* probably null Het
Pros1 T A 16: 62,928,061 N632K probably damaging Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rbm25 T A 12: 83,677,866 H796Q possibly damaging Het
Rnf151 A T 17: 24,718,030 probably null Het
Rps6ka1 A T 4: 133,871,571 L97I probably damaging Het
Sergef T A 7: 46,443,464 T374S probably benign Het
Sh3rf3 G T 10: 59,130,986 G717C probably damaging Het
Slc29a4 C T 5: 142,721,402 T500I possibly damaging Het
Smc1b T A 15: 85,086,121 D977V probably damaging Het
Spata31d1d C T 13: 59,727,015 C902Y probably benign Het
St14 A T 9: 31,103,760 V314D probably damaging Het
Stat3 A T 11: 100,893,670 I602N possibly damaging Het
Stx4a T A 7: 127,846,489 I189N probably damaging Het
Tacc1 A G 8: 25,182,199 S338P probably benign Het
Tcirg1 T A 19: 3,902,424 T315S possibly damaging Het
Tenm4 A T 7: 96,854,719 N1295I probably damaging Het
Tm7sf3 T C 6: 146,603,911 K516E possibly damaging Het
Tmem198b T C 10: 128,801,454 E272G possibly damaging Het
Tnip3 A G 6: 65,605,953 Q237R probably damaging Het
Trim15 C T 17: 36,862,360 probably null Het
Trim30a T A 7: 104,421,450 N252I possibly damaging Het
Ttc39a A G 4: 109,430,878 E227G probably benign Het
Ttll13 A G 7: 80,253,166 E194G probably damaging Het
Upf1 G A 8: 70,344,262 T107I probably benign Het
Vac14 A G 8: 110,710,349 I565V probably damaging Het
Zcchc14 A T 8: 121,611,358 probably benign Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R0497:Pard3b UTSW 1 62440008 splice site probably null
R1264:Pard3b UTSW 1 62164157 missense probably damaging 1.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1482:Pard3b UTSW 1 62166367 missense probably damaging 1.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3712:Pard3b UTSW 1 62343978 missense probably damaging 1.00
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5950:Pard3b UTSW 1 62216531 missense probably benign 0.04
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
R7847:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7879:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62153989 missense probably damaging 1.00
R8125:Pard3b UTSW 1 61767984 missense probably damaging 1.00
R8329:Pard3b UTSW 1 62637798 missense probably benign 0.30
R8766:Pard3b UTSW 1 62159478 missense probably benign 0.35
R8833:Pard3b UTSW 1 62344999 missense probably benign 0.00
Z1176:Pard3b UTSW 1 62238892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTTGCTTGTTCCACCACAG -3'
(R):5'- ACAGCCTCTGTAGCTGACAC -3'

Sequencing Primer
(F):5'- GCTTGTTCCACCACAGGATCC -3'
(R):5'- CCTCTGTAGCTGACACTAATTTATTG -3'
Posted On2017-02-28