Mutagenetix > Incidental Mutation

Incidental Mutation 'R5930:Gria2'

460145

Institutional Source

Beutler Lab

Gene Symbol

Gria2

Ensembl Gene

ENSMUSG00000033981

Gene Name

glutamate receptor, ionotropic, AMPA2 (alpha 2)

Synonyms

Glur2, Glur-2, GluR-B, GluA2, GluR2

MMRRC Submission

044125-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R5930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80681450-80802835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80707249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 495 (I495V)

Ref Sequence

ENSEMBL: ENSMUSP00000141447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075316
AA Change: I495V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: I495V

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	49	379	2.7e-58	PFAM
PBPe	415	790	3.75e-132	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107745
AA Change: I495V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: I495V

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	47	379	4.8e-53	PFAM
PBPe	415	790	8.16e-133	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192463
AA Change: I495V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: I495V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	47	379	1.7e-51	PFAM
PBPe	415	770	1.2e-105	SMART
Lig_chan-Glu_bd	425	490	2.2e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195062

Meta Mutation Damage Score

0.0782

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

94% (102/109)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,397,451	V5572I	probably benign	Het
AF366264	T	A	8: 13,837,263	D276V	probably benign	Het
Agap1	C	T	1: 89,843,096	T656I	probably damaging	Het
Als2cl	C	T	9: 110,887,364	R247W	probably damaging	Het
Ankfy1	A	T	11: 72,712,245	R33S	probably benign	Het
Ano5	T	C	7: 51,585,331	F671L	probably damaging	Het
Arhgap26	A	G	18: 39,150,092	M361V	probably damaging	Het
Bckdk	A	G	7: 127,905,973	E175G	probably damaging	Het
Bptf	G	T	11: 107,073,196	T1724K	probably damaging	Het
Btn2a2	T	A	13: 23,486,228	I112F	probably damaging	Het
Cd163l1	C	T	7: 140,230,446	P984S	probably benign	Het
Cln8	T	A	8: 14,896,621	W212R	probably damaging	Het
Cnbd1	T	C	4: 18,886,119	E300G	probably benign	Het
Cnksr3	T	C	10: 7,142,993	I173V	probably benign	Het
Cntn2	T	A	1: 132,523,432	D484V	probably damaging	Het
Cyp4a14	C	A	4: 115,491,410	G319V	probably damaging	Het
Cyp4f37	G	A	17: 32,629,983	R275Q	possibly damaging	Het
Def8	C	T	8: 123,460,070		probably benign	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Dock6	A	G	9: 21,824,416	V1012A	probably benign	Het
Dus3l	T	A	17: 56,769,579	N586K	probably damaging	Het
Dyrk2	T	A	10: 118,860,268	I362F	probably damaging	Het
Dyx1c1	T	C	9: 72,971,998	V356A	probably damaging	Het
Erc2	T	A	14: 27,776,858	D230E	probably damaging	Het
Fam102b	A	T	3: 108,980,152	S265R	probably benign	Het
Fat1	A	G	8: 45,044,036	H4186R	probably benign	Het
Fbxo44	A	G	4: 148,156,595	F179S	probably damaging	Het
Fech	A	G	18: 64,478,649		probably null	Het
Fer1l5	T	A	1: 36,385,173	C289*	probably null	Het
Fhl5	T	A	4: 25,214,756	D7V	probably benign	Het
Flvcr1	G	T	1: 191,009,551	T514K	probably damaging	Het
Fmo1	A	T	1: 162,839,616		probably null	Het
Gabra6	G	A	11: 42,307,441	T384M	probably benign	Het
Gli3	A	G	13: 15,548,625	Y117C	probably damaging	Het
Gnao1	A	G	8: 93,896,245	D59G	probably benign	Het
Hnf1b	C	A	11: 83,863,985	H161Q	probably benign	Het
Itga8	T	A	2: 12,230,208	D413V	possibly damaging	Het
Itpr3	A	T	17: 27,110,921	Q1563L	possibly damaging	Het
Kctd16	A	G	18: 40,530,829	N337S	probably benign	Het
Klra4	C	T	6: 130,053,053	V190M	possibly damaging	Het
Krtap4-9	T	A	11: 99,785,636		probably benign	Het
L3mbtl1	GGCCG	GG	2: 162,967,336		probably benign	Het
Mchr1	T	C	15: 81,237,843	F265L	probably damaging	Het
Megf8	T	A	7: 25,326,441	Y83*	probably null	Het
Mettl18	A	G	1: 163,997,177	M356V	probably null	Het
Mrm1	G	A	11: 84,819,192	R61W	probably damaging	Het
Muc4	A	T	16: 32,751,705	T528S	probably benign	Het
Myef2	A	T	2: 125,095,731	L530*	probably null	Het
Nhlrc4	T	C	17: 25,943,719	E18G	probably benign	Het
Nisch	C	T	14: 31,173,145	V1065I	probably benign	Het
Nlgn2	C	T	11: 69,834,149	R97H	probably damaging	Het
Nos2	T	C	11: 78,937,915	L321S	probably damaging	Het
Oaz3	T	C	3: 94,436,410	M49V	possibly damaging	Het
Olfm5	A	G	7: 104,154,155	V367A	probably damaging	Het
Olfr130	C	A	17: 38,067,750	A193D	probably benign	Het
Olfr1335	C	T	4: 118,809,378	R162H	probably benign	Het
Olfr564	A	T	7: 102,804,274	R265S	probably damaging	Het
Olfr742	C	A	14: 50,515,792	A196D	probably benign	Het
Olfr77	A	G	9: 19,920,910	K234E	probably damaging	Het
Omd	C	T	13: 49,589,636	P54L	possibly damaging	Het
Pard3b	T	A	1: 61,768,130		probably benign	Het
Pcdhb18	A	C	18: 37,491,935	I773L	possibly damaging	Het
Pde11a	T	C	2: 76,139,831		probably null	Het
Pfkfb4	A	C	9: 109,030,394		probably benign	Het
Phb2	T	G	6: 124,715,649	I260S	probably damaging	Het
Pkd1l1	G	A	11: 8,958,969	T345I	unknown	Het
Pla2g6	T	C	15: 79,303,528		probably benign	Het
Pou4f2	G	A	8: 78,436,391	S5F	unknown	Het
Ppp1r9a	A	T	6: 5,157,002		probably null	Het
Pramel5	A	G	4: 144,272,983	I178T	probably benign	Het
Prom2	C	T	2: 127,530,133	W745*	probably null	Het
Pros1	T	A	16: 62,928,061	N632K	probably damaging	Het
Rab4b	A	G	7: 27,174,502	I117T	probably benign	Het
Rbm25	T	A	12: 83,677,866	H796Q	possibly damaging	Het
Rnf151	A	T	17: 24,718,030		probably null	Het
Rps6ka1	A	T	4: 133,871,571	L97I	probably damaging	Het
Sergef	T	A	7: 46,443,464	T374S	probably benign	Het
Sh3rf3	G	T	10: 59,130,986	G717C	probably damaging	Het
Slc29a4	C	T	5: 142,721,402	T500I	possibly damaging	Het
Smc1b	T	A	15: 85,086,121	D977V	probably damaging	Het
Spata31d1d	C	T	13: 59,727,015	C902Y	probably benign	Het
St14	A	T	9: 31,103,760	V314D	probably damaging	Het
Stat3	A	T	11: 100,893,670	I602N	possibly damaging	Het
Stx4a	T	A	7: 127,846,489	I189N	probably damaging	Het
Tacc1	A	G	8: 25,182,199	S338P	probably benign	Het
Tcirg1	T	A	19: 3,902,424	T315S	possibly damaging	Het
Tenm4	A	T	7: 96,854,719	N1295I	probably damaging	Het
Tm7sf3	T	C	6: 146,603,911	K516E	possibly damaging	Het
Tmem198b	T	C	10: 128,801,454	E272G	possibly damaging	Het
Tnip3	A	G	6: 65,605,953	Q237R	probably damaging	Het
Trim15	C	T	17: 36,862,360		probably null	Het
Trim30a	T	A	7: 104,421,450	N252I	possibly damaging	Het
Ttc39a	A	G	4: 109,430,878	E227G	probably benign	Het
Ttll13	A	G	7: 80,253,166	E194G	probably damaging	Het
Upf1	G	A	8: 70,344,262	T107I	probably benign	Het
Vac14	A	G	8: 110,710,349	I565V	probably damaging	Het
Zcchc14	A	T	8: 121,611,358		probably benign	Het

Other mutations in Gria2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Gria2	APN	3	80710790	missense	probably benign	0.12
IGL00832:Gria2	APN	3	80707251	missense	probably damaging	1.00
IGL01086:Gria2	APN	3	80692381	missense	probably damaging	1.00
IGL01409:Gria2	APN	3	80707697	critical splice donor site	probably null
IGL01924:Gria2	APN	3	80710331	missense	probably benign	0.13
IGL01999:Gria2	APN	3	80732091	missense	probably damaging	1.00
IGL02355:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02362:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02389:Gria2	APN	3	80709422	missense	probably benign	0.14
IGL02444:Gria2	APN	3	80702553	missense	possibly damaging	0.65
IGL02532:Gria2	APN	3	80706999	missense	probably damaging	1.00
IGL02991:Gria2	UTSW	3	80707809	nonsense	probably null
R0015:Gria2	UTSW	3	80707767	missense	probably damaging	1.00
R0148:Gria2	UTSW	3	80707731	missense	probably damaging	1.00
R0201:Gria2	UTSW	3	80707838	missense	probably damaging	1.00
R0411:Gria2	UTSW	3	80710858	splice site	probably benign
R0551:Gria2	UTSW	3	80732026	splice site	probably benign
R0655:Gria2	UTSW	3	80732070	nonsense	probably null
R0866:Gria2	UTSW	3	80722024	splice site	probably benign
R1393:Gria2	UTSW	3	80707098	missense	probably damaging	1.00
R1458:Gria2	UTSW	3	80732045	missense	possibly damaging	0.71
R1563:Gria2	UTSW	3	80691397	missense	probably damaging	0.96
R1771:Gria2	UTSW	3	80692301	nonsense	probably null
R1775:Gria2	UTSW	3	80691338	missense	probably benign	0.09
R1902:Gria2	UTSW	3	80722108	missense	probably damaging	0.98
R1993:Gria2	UTSW	3	80802357	missense	probably benign
R1994:Gria2	UTSW	3	80802357	missense	probably benign
R1995:Gria2	UTSW	3	80802357	missense	probably benign
R2001:Gria2	UTSW	3	80710805	missense	probably benign	0.28
R2389:Gria2	UTSW	3	80702625	missense	probably damaging	1.00
R2520:Gria2	UTSW	3	80706962	missense	probably damaging	1.00
R2679:Gria2	UTSW	3	80740953	splice site	probably benign
R2865:Gria2	UTSW	3	80732085	missense	probably benign	0.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R3716:Gria2	UTSW	3	80741004	missense	possibly damaging	0.77
R3967:Gria2	UTSW	3	80710777	missense	possibly damaging	0.95
R4285:Gria2	UTSW	3	80707662	intron	probably benign
R4611:Gria2	UTSW	3	80692492	missense	probably damaging	0.99
R4612:Gria2	UTSW	3	80732051	missense	probably damaging	1.00
R4616:Gria2	UTSW	3	80706897	missense	probably damaging	1.00
R4706:Gria2	UTSW	3	80740990	missense	probably benign
R4996:Gria2	UTSW	3	80707141	missense	probably damaging	0.99
R5502:Gria2	UTSW	3	80706945	missense	probably damaging	1.00
R6142:Gria2	UTSW	3	80801717	missense	probably benign	0.13
R6233:Gria2	UTSW	3	80707203	missense	probably damaging	0.99
R6317:Gria2	UTSW	3	80741004	missense	possibly damaging	0.79
R6453:Gria2	UTSW	3	80740974	missense	possibly damaging	0.93
R6526:Gria2	UTSW	3	80692469	missense	probably damaging	1.00
R6545:Gria2	UTSW	3	80741144	missense	probably damaging	0.99
R6574:Gria2	UTSW	3	80689296	missense	probably damaging	0.99
R6720:Gria2	UTSW	3	80802304	missense	probably benign	0.37
R7009:Gria2	UTSW	3	80706972	missense	probably damaging	1.00
R7049:Gria2	UTSW	3	80689327	missense	probably damaging	0.99
R7191:Gria2	UTSW	3	80732085	missense	probably benign	0.24
R7225:Gria2	UTSW	3	80802631	unclassified	probably benign
R7374:Gria2	UTSW	3	80741076	missense	probably benign
R7837:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R8034:Gria2	UTSW	3	80801699	missense	probably damaging	1.00
R8125:Gria2	UTSW	3	80707243	missense	possibly damaging	0.88
R8189:Gria2	UTSW	3	80722182	missense	probably damaging	1.00
R8209:Gria2	UTSW	3	80709457	missense	probably benign	0.01
R8362:Gria2	UTSW	3	80707890	missense	possibly damaging	0.82
R8481:Gria2	UTSW	3	80801691	missense	possibly damaging	0.95
R8500:Gria2	UTSW	3	80692467	missense	probably damaging	0.99
R8516:Gria2	UTSW	3	80706987	missense	probably benign	0.27
R8918:Gria2	UTSW	3	80692399	missense	probably damaging	1.00
R8939:Gria2	UTSW	3	80710863	intron	probably benign
R8971:Gria2	UTSW	3	80707893	missense	probably damaging	0.98
R9229:Gria2	UTSW	3	80802382	start codon destroyed	probably null	0.60

Predicted Primers

PCR Primer
(F):5'- TAGGGGCTAAATCTGCTGACC -3'
(R):5'- AGTCAGATAGGCCAACTATTCGTC -3'

Sequencing Primer
(F):5'- TGCTGACCAGGAATAAAACTACACTG -3'
(R):5'- AGATAGGCCAACTATTCGTCTGACTC -3'

Posted On

2017-02-28