Incidental Mutation 'R5930:Oaz3'
ID460146
Institutional Source Beutler Lab
Gene Symbol Oaz3
Ensembl Gene ENSMUSG00000028141
Gene Nameornithine decarboxylase antizyme 3
SynonymsAZ-3, Oaz-t, antizyme 3, AZ3, ornithine decarboxylase antizyme in testis
MMRRC Submission 044125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5930 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94432414-94443915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94436410 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 49 (M49V)
Ref Sequence ENSEMBL: ENSMUSP00000143080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045245] [ENSMUST00000166032] [ENSMUST00000191506] [ENSMUST00000196606] [ENSMUST00000197495] [ENSMUST00000197901] [ENSMUST00000199678] [ENSMUST00000203883] [ENSMUST00000204548] [ENSMUST00000204913]
Predicted Effect probably benign
Transcript: ENSMUST00000045245
SMART Domains Protein: ENSMUSP00000041002
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166032
SMART Domains Protein: ENSMUSP00000129635
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191506
AA Change: M49V

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139408
Gene: ENSMUSG00000028141
AA Change: M49V

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
Pfam:ODC_AZ 137 233 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196606
SMART Domains Protein: ENSMUSP00000143102
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 116 1.5e-11 SMART
KH 119 191 2.4e-17 SMART
TUDOR 348 406 1.7e-8 SMART
low complexity region 425 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196799
Predicted Effect probably benign
Transcript: ENSMUST00000197495
SMART Domains Protein: ENSMUSP00000143135
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 150 3e-18 SMART
TUDOR 307 365 1.7e-8 SMART
low complexity region 384 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197901
SMART Domains Protein: ENSMUSP00000142561
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199318
Predicted Effect possibly damaging
Transcript: ENSMUST00000199678
AA Change: M49V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143080
Gene: ENSMUSG00000028141
AA Change: M49V

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Pfam:ODC_AZ 90 186 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203883
SMART Domains Protein: ENSMUSP00000145484
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:ODC_AZ 91 189 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204548
SMART Domains Protein: ENSMUSP00000145079
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204913
AA Change: M49V

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145113
Gene: ENSMUSG00000028141
AA Change: M49V

DomainStartEndE-ValueType
low complexity region 71 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204980
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. This transcript initiates translation from a non-AUG (CUG) codon that is highly conserved among the antizyme 3 orthologs. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to detachment of sperm tail and head during sperm maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,397,451 V5572I probably benign Het
AF366264 T A 8: 13,837,263 D276V probably benign Het
Agap1 C T 1: 89,843,096 T656I probably damaging Het
Als2cl C T 9: 110,887,364 R247W probably damaging Het
Ankfy1 A T 11: 72,712,245 R33S probably benign Het
Ano5 T C 7: 51,585,331 F671L probably damaging Het
Arhgap26 A G 18: 39,150,092 M361V probably damaging Het
Bckdk A G 7: 127,905,973 E175G probably damaging Het
Bptf G T 11: 107,073,196 T1724K probably damaging Het
Btn2a2 T A 13: 23,486,228 I112F probably damaging Het
Cd163l1 C T 7: 140,230,446 P984S probably benign Het
Cln8 T A 8: 14,896,621 W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 E300G probably benign Het
Cnksr3 T C 10: 7,142,993 I173V probably benign Het
Cntn2 T A 1: 132,523,432 D484V probably damaging Het
Cyp4a14 C A 4: 115,491,410 G319V probably damaging Het
Cyp4f37 G A 17: 32,629,983 R275Q possibly damaging Het
Def8 C T 8: 123,460,070 probably benign Het
Dnah10 T C 5: 124,791,791 probably null Het
Dock6 A G 9: 21,824,416 V1012A probably benign Het
Dus3l T A 17: 56,769,579 N586K probably damaging Het
Dyrk2 T A 10: 118,860,268 I362F probably damaging Het
Dyx1c1 T C 9: 72,971,998 V356A probably damaging Het
Erc2 T A 14: 27,776,858 D230E probably damaging Het
Fam102b A T 3: 108,980,152 S265R probably benign Het
Fat1 A G 8: 45,044,036 H4186R probably benign Het
Fbxo44 A G 4: 148,156,595 F179S probably damaging Het
Fech A G 18: 64,478,649 probably null Het
Fer1l5 T A 1: 36,385,173 C289* probably null Het
Fhl5 T A 4: 25,214,756 D7V probably benign Het
Flvcr1 G T 1: 191,009,551 T514K probably damaging Het
Fmo1 A T 1: 162,839,616 probably null Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gli3 A G 13: 15,548,625 Y117C probably damaging Het
Gnao1 A G 8: 93,896,245 D59G probably benign Het
Gria2 T C 3: 80,707,249 I495V possibly damaging Het
Hnf1b C A 11: 83,863,985 H161Q probably benign Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Itpr3 A T 17: 27,110,921 Q1563L possibly damaging Het
Kctd16 A G 18: 40,530,829 N337S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Krtap4-9 T A 11: 99,785,636 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Mchr1 T C 15: 81,237,843 F265L probably damaging Het
Megf8 T A 7: 25,326,441 Y83* probably null Het
Mettl18 A G 1: 163,997,177 M356V probably null Het
Mrm1 G A 11: 84,819,192 R61W probably damaging Het
Muc4 A T 16: 32,751,705 T528S probably benign Het
Myef2 A T 2: 125,095,731 L530* probably null Het
Nhlrc4 T C 17: 25,943,719 E18G probably benign Het
Nisch C T 14: 31,173,145 V1065I probably benign Het
Nlgn2 C T 11: 69,834,149 R97H probably damaging Het
Nos2 T C 11: 78,937,915 L321S probably damaging Het
Olfm5 A G 7: 104,154,155 V367A probably damaging Het
Olfr130 C A 17: 38,067,750 A193D probably benign Het
Olfr1335 C T 4: 118,809,378 R162H probably benign Het
Olfr564 A T 7: 102,804,274 R265S probably damaging Het
Olfr742 C A 14: 50,515,792 A196D probably benign Het
Olfr77 A G 9: 19,920,910 K234E probably damaging Het
Omd C T 13: 49,589,636 P54L possibly damaging Het
Pard3b T A 1: 61,768,130 probably benign Het
Pcdhb18 A C 18: 37,491,935 I773L possibly damaging Het
Pde11a T C 2: 76,139,831 probably null Het
Pfkfb4 A C 9: 109,030,394 probably benign Het
Phb2 T G 6: 124,715,649 I260S probably damaging Het
Pkd1l1 G A 11: 8,958,969 T345I unknown Het
Pla2g6 T C 15: 79,303,528 probably benign Het
Pou4f2 G A 8: 78,436,391 S5F unknown Het
Ppp1r9a A T 6: 5,157,002 probably null Het
Pramel5 A G 4: 144,272,983 I178T probably benign Het
Prom2 C T 2: 127,530,133 W745* probably null Het
Pros1 T A 16: 62,928,061 N632K probably damaging Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rbm25 T A 12: 83,677,866 H796Q possibly damaging Het
Rnf151 A T 17: 24,718,030 probably null Het
Rps6ka1 A T 4: 133,871,571 L97I probably damaging Het
Sergef T A 7: 46,443,464 T374S probably benign Het
Sh3rf3 G T 10: 59,130,986 G717C probably damaging Het
Slc29a4 C T 5: 142,721,402 T500I possibly damaging Het
Smc1b T A 15: 85,086,121 D977V probably damaging Het
Spata31d1d C T 13: 59,727,015 C902Y probably benign Het
St14 A T 9: 31,103,760 V314D probably damaging Het
Stat3 A T 11: 100,893,670 I602N possibly damaging Het
Stx4a T A 7: 127,846,489 I189N probably damaging Het
Tacc1 A G 8: 25,182,199 S338P probably benign Het
Tcirg1 T A 19: 3,902,424 T315S possibly damaging Het
Tenm4 A T 7: 96,854,719 N1295I probably damaging Het
Tm7sf3 T C 6: 146,603,911 K516E possibly damaging Het
Tmem198b T C 10: 128,801,454 E272G possibly damaging Het
Tnip3 A G 6: 65,605,953 Q237R probably damaging Het
Trim15 C T 17: 36,862,360 probably null Het
Trim30a T A 7: 104,421,450 N252I possibly damaging Het
Ttc39a A G 4: 109,430,878 E227G probably benign Het
Ttll13 A G 7: 80,253,166 E194G probably damaging Het
Upf1 G A 8: 70,344,262 T107I probably benign Het
Vac14 A G 8: 110,710,349 I565V probably damaging Het
Zcchc14 A T 8: 121,611,358 probably benign Het
Other mutations in Oaz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Oaz3 APN 3 94434980 missense probably benign 0.15
PIT4366001:Oaz3 UTSW 3 94433594 missense unknown
PIT4791001:Oaz3 UTSW 3 94433545 missense unknown
R1004:Oaz3 UTSW 3 94435043 missense probably damaging 1.00
R1833:Oaz3 UTSW 3 94436042 unclassified probably benign
R2230:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2231:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2232:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R4487:Oaz3 UTSW 3 94435130 splice site probably null
R4776:Oaz3 UTSW 3 94434998 missense probably benign 0.00
R5502:Oaz3 UTSW 3 94435085 missense probably damaging 1.00
R6212:Oaz3 UTSW 3 94435068 missense probably benign 0.23
R6362:Oaz3 UTSW 3 94434988 missense probably damaging 0.99
R8247:Oaz3 UTSW 3 94436434 missense probably damaging 1.00
R8273:Oaz3 UTSW 3 94435127 missense probably damaging 1.00
R8537:Oaz3 UTSW 3 94436435 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTTCAGCTACCCAGGAC -3'
(R):5'- ACTTATCCGCTGAACCTCAC -3'

Sequencing Primer
(F):5'- GGACCAGTCTTCCAACACTG -3'
(R):5'- GAACCTCACTTTGCCGCAG -3'
Posted On2017-02-28