Mutagenetix > Incidental Mutation

Incidental Mutation 'R5930:Fhl5'

460148

Institutional Source

Beutler Lab

Gene Symbol

Fhl5

Ensembl Gene

ENSMUSG00000028259

Gene Name

four and a half LIM domains 5

Synonyms

ACT, 1700027G07Rik

MMRRC Submission

044125-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R5930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25199908-25242876 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25214756 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 7 (D7V)

Ref Sequence

ENSEMBL: ENSMUSP00000103839 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029922] [ENSMUST00000108204]

AlphaFold

Q9WTX7

Predicted Effect

probably benign
Transcript: ENSMUST00000029922
AA Change: D7V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000029922
Gene: ENSMUSG00000028259
AA Change: D7V

Domain	Start	End	E-Value	Type
LIM	40	93	1.91e-11	SMART
LIM	101	154	4.59e-14	SMART
LIM	162	213	3.7e-9	SMART
LIM	221	276	7.68e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108204
AA Change: D7V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000103839
Gene: ENSMUSG00000028259
AA Change: D7V

Domain	Start	End	E-Value	Type
LIM	40	93	1.91e-11	SMART
LIM	101	154	4.59e-14	SMART
LIM	162	213	3.7e-9	SMART
LIM	221	276	7.68e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124792

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

94% (102/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
PHENOTYPE: Male mice homozygous for disruptions of this gene have reduced sperm counts and abnormal sperm but are none the less fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,397,451	V5572I	probably benign	Het
AF366264	T	A	8: 13,837,263	D276V	probably benign	Het
Agap1	C	T	1: 89,843,096	T656I	probably damaging	Het
Als2cl	C	T	9: 110,887,364	R247W	probably damaging	Het
Ankfy1	A	T	11: 72,712,245	R33S	probably benign	Het
Ano5	T	C	7: 51,585,331	F671L	probably damaging	Het
Arhgap26	A	G	18: 39,150,092	M361V	probably damaging	Het
Bckdk	A	G	7: 127,905,973	E175G	probably damaging	Het
Bptf	G	T	11: 107,073,196	T1724K	probably damaging	Het
Btn2a2	T	A	13: 23,486,228	I112F	probably damaging	Het
Cd163l1	C	T	7: 140,230,446	P984S	probably benign	Het
Cln8	T	A	8: 14,896,621	W212R	probably damaging	Het
Cnbd1	T	C	4: 18,886,119	E300G	probably benign	Het
Cnksr3	T	C	10: 7,142,993	I173V	probably benign	Het
Cntn2	T	A	1: 132,523,432	D484V	probably damaging	Het
Cyp4a14	C	A	4: 115,491,410	G319V	probably damaging	Het
Cyp4f37	G	A	17: 32,629,983	R275Q	possibly damaging	Het
Def8	C	T	8: 123,460,070		probably benign	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Dock6	A	G	9: 21,824,416	V1012A	probably benign	Het
Dus3l	T	A	17: 56,769,579	N586K	probably damaging	Het
Dyrk2	T	A	10: 118,860,268	I362F	probably damaging	Het
Dyx1c1	T	C	9: 72,971,998	V356A	probably damaging	Het
Erc2	T	A	14: 27,776,858	D230E	probably damaging	Het
Fam102b	A	T	3: 108,980,152	S265R	probably benign	Het
Fat1	A	G	8: 45,044,036	H4186R	probably benign	Het
Fbxo44	A	G	4: 148,156,595	F179S	probably damaging	Het
Fech	A	G	18: 64,478,649		probably null	Het
Fer1l5	T	A	1: 36,385,173	C289*	probably null	Het
Flvcr1	G	T	1: 191,009,551	T514K	probably damaging	Het
Fmo1	A	T	1: 162,839,616		probably null	Het
Gabra6	G	A	11: 42,307,441	T384M	probably benign	Het
Gli3	A	G	13: 15,548,625	Y117C	probably damaging	Het
Gnao1	A	G	8: 93,896,245	D59G	probably benign	Het
Gria2	T	C	3: 80,707,249	I495V	possibly damaging	Het
Hnf1b	C	A	11: 83,863,985	H161Q	probably benign	Het
Itga8	T	A	2: 12,230,208	D413V	possibly damaging	Het
Itpr3	A	T	17: 27,110,921	Q1563L	possibly damaging	Het
Kctd16	A	G	18: 40,530,829	N337S	probably benign	Het
Klra4	C	T	6: 130,053,053	V190M	possibly damaging	Het
Krtap4-9	T	A	11: 99,785,636		probably benign	Het
L3mbtl1	GGCCG	GG	2: 162,967,336		probably benign	Het
Mchr1	T	C	15: 81,237,843	F265L	probably damaging	Het
Megf8	T	A	7: 25,326,441	Y83*	probably null	Het
Mettl18	A	G	1: 163,997,177	M356V	probably null	Het
Mrm1	G	A	11: 84,819,192	R61W	probably damaging	Het
Muc4	A	T	16: 32,751,705	T528S	probably benign	Het
Myef2	A	T	2: 125,095,731	L530*	probably null	Het
Nhlrc4	T	C	17: 25,943,719	E18G	probably benign	Het
Nisch	C	T	14: 31,173,145	V1065I	probably benign	Het
Nlgn2	C	T	11: 69,834,149	R97H	probably damaging	Het
Nos2	T	C	11: 78,937,915	L321S	probably damaging	Het
Oaz3	T	C	3: 94,436,410	M49V	possibly damaging	Het
Olfm5	A	G	7: 104,154,155	V367A	probably damaging	Het
Olfr130	C	A	17: 38,067,750	A193D	probably benign	Het
Olfr1335	C	T	4: 118,809,378	R162H	probably benign	Het
Olfr564	A	T	7: 102,804,274	R265S	probably damaging	Het
Olfr742	C	A	14: 50,515,792	A196D	probably benign	Het
Olfr77	A	G	9: 19,920,910	K234E	probably damaging	Het
Omd	C	T	13: 49,589,636	P54L	possibly damaging	Het
Pard3b	T	A	1: 61,768,130		probably benign	Het
Pcdhb18	A	C	18: 37,491,935	I773L	possibly damaging	Het
Pde11a	T	C	2: 76,139,831		probably null	Het
Pfkfb4	A	C	9: 109,030,394		probably benign	Het
Phb2	T	G	6: 124,715,649	I260S	probably damaging	Het
Pkd1l1	G	A	11: 8,958,969	T345I	unknown	Het
Pla2g6	T	C	15: 79,303,528		probably benign	Het
Pou4f2	G	A	8: 78,436,391	S5F	unknown	Het
Ppp1r9a	A	T	6: 5,157,002		probably null	Het
Pramel5	A	G	4: 144,272,983	I178T	probably benign	Het
Prom2	C	T	2: 127,530,133	W745*	probably null	Het
Pros1	T	A	16: 62,928,061	N632K	probably damaging	Het
Rab4b	A	G	7: 27,174,502	I117T	probably benign	Het
Rbm25	T	A	12: 83,677,866	H796Q	possibly damaging	Het
Rnf151	A	T	17: 24,718,030		probably null	Het
Rps6ka1	A	T	4: 133,871,571	L97I	probably damaging	Het
Sergef	T	A	7: 46,443,464	T374S	probably benign	Het
Sh3rf3	G	T	10: 59,130,986	G717C	probably damaging	Het
Slc29a4	C	T	5: 142,721,402	T500I	possibly damaging	Het
Smc1b	T	A	15: 85,086,121	D977V	probably damaging	Het
Spata31d1d	C	T	13: 59,727,015	C902Y	probably benign	Het
St14	A	T	9: 31,103,760	V314D	probably damaging	Het
Stat3	A	T	11: 100,893,670	I602N	possibly damaging	Het
Stx4a	T	A	7: 127,846,489	I189N	probably damaging	Het
Tacc1	A	G	8: 25,182,199	S338P	probably benign	Het
Tcirg1	T	A	19: 3,902,424	T315S	possibly damaging	Het
Tenm4	A	T	7: 96,854,719	N1295I	probably damaging	Het
Tm7sf3	T	C	6: 146,603,911	K516E	possibly damaging	Het
Tmem198b	T	C	10: 128,801,454	E272G	possibly damaging	Het
Tnip3	A	G	6: 65,605,953	Q237R	probably damaging	Het
Trim15	C	T	17: 36,862,360		probably null	Het
Trim30a	T	A	7: 104,421,450	N252I	possibly damaging	Het
Ttc39a	A	G	4: 109,430,878	E227G	probably benign	Het
Ttll13	A	G	7: 80,253,166	E194G	probably damaging	Het
Upf1	G	A	8: 70,344,262	T107I	probably benign	Het
Vac14	A	G	8: 110,710,349	I565V	probably damaging	Het
Zcchc14	A	T	8: 121,611,358		probably benign	Het

Other mutations in Fhl5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00980:Fhl5	APN	4	25207181	missense	possibly damaging	0.95
IGL02194:Fhl5	APN	4	25211341	missense	probably benign	0.01
IGL03172:Fhl5	APN	4	25211309	missense	probably damaging	1.00
PIT4466001:Fhl5	UTSW	4	25211194	missense	probably damaging	1.00
PIT4472001:Fhl5	UTSW	4	25211194	missense	probably damaging	1.00
R0020:Fhl5	UTSW	4	25200054	missense	probably benign	0.15
R0020:Fhl5	UTSW	4	25200054	missense	probably benign	0.15
R0256:Fhl5	UTSW	4	25213624	missense	probably benign
R0304:Fhl5	UTSW	4	25207241	missense	probably benign	0.01
R0480:Fhl5	UTSW	4	25207101	nonsense	probably null
R0563:Fhl5	UTSW	4	25213610	missense	probably damaging	0.96
R3418:Fhl5	UTSW	4	25211252	missense	probably benign
R3926:Fhl5	UTSW	4	25214790	splice site	probably benign
R4382:Fhl5	UTSW	4	25200118	missense	probably benign	0.16
R6135:Fhl5	UTSW	4	25214716	nonsense	probably null
R6927:Fhl5	UTSW	4	25213681	missense	probably benign	0.14
R7147:Fhl5	UTSW	4	25213777	critical splice acceptor site	probably null
R7975:Fhl5	UTSW	4	25214730	missense	probably benign
R8213:Fhl5	UTSW	4	25207113	nonsense	probably null
R9609:Fhl5	UTSW	4	25214653	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCATCCTGAAGCAATGACC -3'
(R):5'- GGTAGCCTTTTCTAAATCACCATG -3'

Sequencing Primer
(F):5'- AGCAATGACCTACTATATATGAGCAG -3'
(R):5'- CTCAAATGCTTGACTCACATT -3'

Posted On

2017-02-28