Incidental Mutation 'R0563:Nectin1'
ID46015
Institutional Source Beutler Lab
Gene Symbol Nectin1
Ensembl Gene ENSMUSG00000032012
Gene Namenectin cell adhesion molecule 1
SynonymsHveC, Pvrl1, HIgR, nectin-1, PRR, Cd111, PRR1
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R0563 (G1)
Quality Score184
Status Validated
Chromosome9
Chromosomal Location43743984-43807461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43791045 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000034510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034510] [ENSMUST00000216893]
PDB Structure
Solution structure of the third Immunoglobulin-like domain of nectin-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034510
AA Change: T30A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034510
Gene: ENSMUSG00000032012
AA Change: T30A

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
IG 36 143 8.51e-7 SMART
Pfam:C2-set_2 148 237 8.5e-21 PFAM
IG 254 334 1.28e-1 SMART
transmembrane domain 355 377 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216893
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice exhibit eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses, and open eyelids at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Nectin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nectin1 APN 9 43791258 nonsense probably null
IGL01939:Nectin1 APN 9 43792574 unclassified probably benign
IGL01978:Nectin1 APN 9 43792147 missense probably damaging 0.99
IGL02795:Nectin1 APN 9 43803552 missense probably benign
K3955:Nectin1 UTSW 9 43792078 missense probably damaging 1.00
R1439:Nectin1 UTSW 9 43792099 missense possibly damaging 0.78
R1822:Nectin1 UTSW 9 43791077 nonsense probably null
R4356:Nectin1 UTSW 9 43792505 missense probably benign 0.22
R5153:Nectin1 UTSW 9 43803498 missense probably damaging 0.99
R5516:Nectin1 UTSW 9 43803793 missense probably benign 0.03
R5864:Nectin1 UTSW 9 43791310 missense probably damaging 1.00
R6903:Nectin1 UTSW 9 43791882 missense possibly damaging 0.95
R7791:Nectin1 UTSW 9 43792039 missense probably benign 0.08
R7878:Nectin1 UTSW 9 43803901 missense probably benign 0.10
R7961:Nectin1 UTSW 9 43803901 missense probably benign 0.10
R8046:Nectin1 UTSW 9 43792501 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCGTAACACATACACATGCAAA -3'
(R):5'- ACACACCCATAGTCGGGTTGTAGAT -3'

Sequencing Primer
(F):5'- ttgtgggtgtgtggggg -3'
(R):5'- AAGCTACAGTGCAGTACCAC -3'
Posted On2013-06-11