Incidental Mutation 'R5930:Cyp4a14'
ID 460150
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 044125-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5930 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115348607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 319 (G319V)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: G319V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: G319V

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.9530 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,545,570 (GRCm39) V5572I probably benign Het
Agap1 C T 1: 89,770,818 (GRCm39) T656I probably damaging Het
Als2cl C T 9: 110,716,432 (GRCm39) R247W probably damaging Het
Ankfy1 A T 11: 72,603,071 (GRCm39) R33S probably benign Het
Ano5 T C 7: 51,235,079 (GRCm39) F671L probably damaging Het
Arhgap26 A G 18: 39,283,145 (GRCm39) M361V probably damaging Het
Bckdk A G 7: 127,505,145 (GRCm39) E175G probably damaging Het
Bptf G T 11: 106,964,022 (GRCm39) T1724K probably damaging Het
Btn2a2 T A 13: 23,670,398 (GRCm39) I112F probably damaging Het
Cln8 T A 8: 14,946,621 (GRCm39) W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 (GRCm39) E300G probably benign Het
Cnksr3 T C 10: 7,092,993 (GRCm39) I173V probably benign Het
Cntn2 T A 1: 132,451,170 (GRCm39) D484V probably damaging Het
Cyp4f37 G A 17: 32,848,957 (GRCm39) R275Q possibly damaging Het
Def8 C T 8: 124,186,809 (GRCm39) probably benign Het
Dnaaf4 T C 9: 72,879,280 (GRCm39) V356A probably damaging Het
Dnah10 T C 5: 124,868,855 (GRCm39) probably null Het
Dock6 A G 9: 21,735,712 (GRCm39) V1012A probably benign Het
Dus3l T A 17: 57,076,579 (GRCm39) N586K probably damaging Het
Dyrk2 T A 10: 118,696,173 (GRCm39) I362F probably damaging Het
Eeig2 A T 3: 108,887,468 (GRCm39) S265R probably benign Het
Erc2 T A 14: 27,498,815 (GRCm39) D230E probably damaging Het
Fat1 A G 8: 45,497,073 (GRCm39) H4186R probably benign Het
Fbxo44 A G 4: 148,241,052 (GRCm39) F179S probably damaging Het
Fech A G 18: 64,611,720 (GRCm39) probably null Het
Fer1l5 T A 1: 36,424,254 (GRCm39) C289* probably null Het
Fhl5 T A 4: 25,214,756 (GRCm39) D7V probably benign Het
Flvcr1 G T 1: 190,741,748 (GRCm39) T514K probably damaging Het
Fmo1 A T 1: 162,667,185 (GRCm39) probably null Het
Gabra6 G A 11: 42,198,268 (GRCm39) T384M probably benign Het
Gli3 A G 13: 15,723,210 (GRCm39) Y117C probably damaging Het
Gnao1 A G 8: 94,622,873 (GRCm39) D59G probably benign Het
Gria2 T C 3: 80,614,556 (GRCm39) I495V possibly damaging Het
Hnf1b C A 11: 83,754,811 (GRCm39) H161Q probably benign Het
Itga8 T A 2: 12,235,019 (GRCm39) D413V possibly damaging Het
Itpr3 A T 17: 27,329,895 (GRCm39) Q1563L possibly damaging Het
Kctd16 A G 18: 40,663,882 (GRCm39) N337S probably benign Het
Klra4 C T 6: 130,030,016 (GRCm39) V190M possibly damaging Het
Krtap4-9 T A 11: 99,676,462 (GRCm39) probably benign Het
L3mbtl1 GGCCG GG 2: 162,809,256 (GRCm39) probably benign Het
Mchr1 T C 15: 81,122,044 (GRCm39) F265L probably damaging Het
Megf8 T A 7: 25,025,866 (GRCm39) Y83* probably null Het
Mettl18 A G 1: 163,824,746 (GRCm39) M356V probably null Het
Mrm1 G A 11: 84,710,018 (GRCm39) R61W probably damaging Het
Muc4 A T 16: 32,570,523 (GRCm39) T528S probably benign Het
Myef2 A T 2: 124,937,651 (GRCm39) L530* probably null Het
Nhlrc4 T C 17: 26,162,693 (GRCm39) E18G probably benign Het
Nisch C T 14: 30,895,102 (GRCm39) V1065I probably benign Het
Nlgn2 C T 11: 69,724,975 (GRCm39) R97H probably damaging Het
Nos2 T C 11: 78,828,741 (GRCm39) L321S probably damaging Het
Oaz3 T C 3: 94,343,717 (GRCm39) M49V possibly damaging Het
Olfm5 A G 7: 103,803,362 (GRCm39) V367A probably damaging Het
Omd C T 13: 49,743,112 (GRCm39) P54L possibly damaging Het
Or10ak12 C T 4: 118,666,575 (GRCm39) R162H probably benign Het
Or11g26 C A 14: 50,753,249 (GRCm39) A196D probably benign Het
Or2g7 C A 17: 38,378,641 (GRCm39) A193D probably benign Het
Or51f23 A T 7: 102,453,481 (GRCm39) R265S probably damaging Het
Or7d10 A G 9: 19,832,206 (GRCm39) K234E probably damaging Het
Pard3b T A 1: 61,807,289 (GRCm39) probably benign Het
Pcdhb18 A C 18: 37,624,988 (GRCm39) I773L possibly damaging Het
Pde11a T C 2: 75,970,175 (GRCm39) probably null Het
Pfkfb4 A C 9: 108,859,462 (GRCm39) probably benign Het
Phb2 T G 6: 124,692,612 (GRCm39) I260S probably damaging Het
Pkd1l1 G A 11: 8,908,969 (GRCm39) T345I unknown Het
Pla2g6 T C 15: 79,187,728 (GRCm39) probably benign Het
Pou4f2 G A 8: 79,163,020 (GRCm39) S5F unknown Het
Ppp1r9a A T 6: 5,157,002 (GRCm39) probably null Het
Pramel5 A G 4: 143,999,553 (GRCm39) I178T probably benign Het
Prom2 C T 2: 127,372,053 (GRCm39) W745* probably null Het
Pros1 T A 16: 62,748,424 (GRCm39) N632K probably damaging Het
Rab4b A G 7: 26,873,927 (GRCm39) I117T probably benign Het
Rbm25 T A 12: 83,724,640 (GRCm39) H796Q possibly damaging Het
Rnf151 A T 17: 24,937,004 (GRCm39) probably null Het
Rps6ka1 A T 4: 133,598,882 (GRCm39) L97I probably damaging Het
Scart1 C T 7: 139,810,359 (GRCm39) P984S probably benign Het
Semp2l2a T A 8: 13,887,263 (GRCm39) D276V probably benign Het
Sergef T A 7: 46,092,888 (GRCm39) T374S probably benign Het
Sh3rf3 G T 10: 58,966,808 (GRCm39) G717C probably damaging Het
Slc29a4 C T 5: 142,707,157 (GRCm39) T500I possibly damaging Het
Smc1b T A 15: 84,970,322 (GRCm39) D977V probably damaging Het
Spata31d1d C T 13: 59,874,829 (GRCm39) C902Y probably benign Het
St14 A T 9: 31,015,056 (GRCm39) V314D probably damaging Het
Stat3 A T 11: 100,784,496 (GRCm39) I602N possibly damaging Het
Stx4a T A 7: 127,445,661 (GRCm39) I189N probably damaging Het
Tacc1 A G 8: 25,672,215 (GRCm39) S338P probably benign Het
Tcirg1 T A 19: 3,952,424 (GRCm39) T315S possibly damaging Het
Tenm4 A T 7: 96,503,926 (GRCm39) N1295I probably damaging Het
Tm7sf3 T C 6: 146,505,409 (GRCm39) K516E possibly damaging Het
Tmem198b T C 10: 128,637,323 (GRCm39) E272G possibly damaging Het
Tnip3 A G 6: 65,582,937 (GRCm39) Q237R probably damaging Het
Trim15 C T 17: 37,173,252 (GRCm39) probably null Het
Trim30a T A 7: 104,070,657 (GRCm39) N252I possibly damaging Het
Ttc39a A G 4: 109,288,075 (GRCm39) E227G probably benign Het
Ttll13 A G 7: 79,902,914 (GRCm39) E194G probably damaging Het
Upf1 G A 8: 70,796,912 (GRCm39) T107I probably benign Het
Vac14 A G 8: 111,436,981 (GRCm39) I565V probably damaging Het
Zcchc14 A T 8: 122,338,097 (GRCm39) probably benign Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGTCCCTGAAATGAAGCCC -3'
(R):5'- GACACTTGGATTTCTTGGACATCC -3'

Sequencing Primer
(F):5'- TGAAGCCCATCCTGAAGAGTC -3'
(R):5'- ACATCCTCTTGTTTGCCAGAGTGAG -3'
Posted On 2017-02-28