Incidental Mutation 'R0563:Elovl4'
ID46017
Institutional Source Beutler Lab
Gene Symbol Elovl4
Ensembl Gene ENSMUSG00000032262
Gene Nameelongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Synonyms
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location83778692-83806277 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 83785034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034796] [ENSMUST00000183614]
Predicted Effect probably null
Transcript: ENSMUST00000034796
SMART Domains Protein: ENSMUSP00000034796
Gene: ENSMUSG00000032262

DomainStartEndE-ValueType
Pfam:ELO 41 278 1e-69 PFAM
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183614
SMART Domains Protein: ENSMUSP00000139163
Gene: ENSMUSG00000032262

DomainStartEndE-ValueType
Pfam:ELO 9 181 1.6e-50 PFAM
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before or around birth. Mice heterozygous for a null allele breed poorly and display mild retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Elovl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
hershey UTSW 9 83806038 start codon destroyed probably null 0.31
R0278:Elovl4 UTSW 9 83783195 missense probably benign 0.00
R0739:Elovl4 UTSW 9 83785109 missense probably damaging 1.00
R0771:Elovl4 UTSW 9 83785115 missense possibly damaging 0.95
R1970:Elovl4 UTSW 9 83780719 missense probably damaging 1.00
R2316:Elovl4 UTSW 9 83780773 missense probably damaging 1.00
R3777:Elovl4 UTSW 9 83785148 frame shift probably null
R3779:Elovl4 UTSW 9 83785148 frame shift probably null
R4823:Elovl4 UTSW 9 83780685 missense probably damaging 1.00
R4827:Elovl4 UTSW 9 83806038 start codon destroyed probably null 0.31
R5264:Elovl4 UTSW 9 83780764 missense probably benign 0.19
R5275:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5295:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5361:Elovl4 UTSW 9 83790101 missense possibly damaging 0.95
R5364:Elovl4 UTSW 9 83790023 missense probably benign 0.21
R5897:Elovl4 UTSW 9 83790104 missense possibly damaging 0.50
R6433:Elovl4 UTSW 9 83785178 missense possibly damaging 0.46
R6668:Elovl4 UTSW 9 83805986 missense probably benign 0.02
R6844:Elovl4 UTSW 9 83790111 missense probably benign 0.09
R6897:Elovl4 UTSW 9 83783225 missense probably benign 0.05
R6933:Elovl4 UTSW 9 83785100 missense probably damaging 1.00
R7534:Elovl4 UTSW 9 83790119 missense probably damaging 1.00
R7544:Elovl4 UTSW 9 83783218 missense probably damaging 1.00
R7843:Elovl4 UTSW 9 83788271 missense probably damaging 1.00
R7926:Elovl4 UTSW 9 83788271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTAGAGCAAATCTCTGCCCAGC -3'
(R):5'- AGGTCTGAAACCTACCTCTCGGAAG -3'

Sequencing Primer
(F):5'- GCGTTCTATCAGATCAGAACTGC -3'
(R):5'- TACCTCTCGGAAGAACGATTGC -3'
Posted On2013-06-11