Mutagenetix > Incidental Mutation

Incidental Mutation 'R5930:St14'

460185

Institutional Source

Beutler Lab

Gene Symbol

St14

Ensembl Gene

ENSMUSG00000031995

Gene Name

suppression of tumorigenicity 14 (colon carcinoma)

Synonyms

MT-SP1, matriptase, Tmprss14, Prss14, Epithin

MMRRC Submission

044125-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31089402-31131853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31103760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 314 (V314D)

Ref Sequence

ENSEMBL: ENSMUSP00000034478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034478] [ENSMUST00000123557] [ENSMUST00000214418]

AlphaFold

P56677

Predicted Effect

probably damaging
Transcript: ENSMUST00000034478
AA Change: V314D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: V314D

Domain	Start	End	E-Value	Type
transmembrane domain	55	77	N/A	INTRINSIC
Pfam:SEA	88	181	7.9e-17	PFAM
CUB	214	334	4.24e-14	SMART
CUB	340	447	4.37e-25	SMART
LDLa	452	486	2.31e-9	SMART
LDLa	487	523	4.08e-10	SMART
LDLa	524	561	3.98e-13	SMART
LDLa	566	604	1.48e-7	SMART
Tryp_SPc	614	849	1.25e-93	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133904

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148789

Predicted Effect

probably benign
Transcript: ENSMUST00000214418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217404

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

94% (102/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,397,451	V5572I	probably benign	Het
AF366264	T	A	8: 13,837,263	D276V	probably benign	Het
Agap1	C	T	1: 89,843,096	T656I	probably damaging	Het
Als2cl	C	T	9: 110,887,364	R247W	probably damaging	Het
Ankfy1	A	T	11: 72,712,245	R33S	probably benign	Het
Ano5	T	C	7: 51,585,331	F671L	probably damaging	Het
Arhgap26	A	G	18: 39,150,092	M361V	probably damaging	Het
Bckdk	A	G	7: 127,905,973	E175G	probably damaging	Het
Bptf	G	T	11: 107,073,196	T1724K	probably damaging	Het
Btn2a2	T	A	13: 23,486,228	I112F	probably damaging	Het
Cd163l1	C	T	7: 140,230,446	P984S	probably benign	Het
Cln8	T	A	8: 14,896,621	W212R	probably damaging	Het
Cnbd1	T	C	4: 18,886,119	E300G	probably benign	Het
Cnksr3	T	C	10: 7,142,993	I173V	probably benign	Het
Cntn2	T	A	1: 132,523,432	D484V	probably damaging	Het
Cyp4a14	C	A	4: 115,491,410	G319V	probably damaging	Het
Cyp4f37	G	A	17: 32,629,983	R275Q	possibly damaging	Het
Def8	C	T	8: 123,460,070		probably benign	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Dock6	A	G	9: 21,824,416	V1012A	probably benign	Het
Dus3l	T	A	17: 56,769,579	N586K	probably damaging	Het
Dyrk2	T	A	10: 118,860,268	I362F	probably damaging	Het
Dyx1c1	T	C	9: 72,971,998	V356A	probably damaging	Het
Erc2	T	A	14: 27,776,858	D230E	probably damaging	Het
Fam102b	A	T	3: 108,980,152	S265R	probably benign	Het
Fat1	A	G	8: 45,044,036	H4186R	probably benign	Het
Fbxo44	A	G	4: 148,156,595	F179S	probably damaging	Het
Fech	A	G	18: 64,478,649		probably null	Het
Fer1l5	T	A	1: 36,385,173	C289*	probably null	Het
Fhl5	T	A	4: 25,214,756	D7V	probably benign	Het
Flvcr1	G	T	1: 191,009,551	T514K	probably damaging	Het
Fmo1	A	T	1: 162,839,616		probably null	Het
Gabra6	G	A	11: 42,307,441	T384M	probably benign	Het
Gli3	A	G	13: 15,548,625	Y117C	probably damaging	Het
Gnao1	A	G	8: 93,896,245	D59G	probably benign	Het
Gria2	T	C	3: 80,707,249	I495V	possibly damaging	Het
Hnf1b	C	A	11: 83,863,985	H161Q	probably benign	Het
Itga8	T	A	2: 12,230,208	D413V	possibly damaging	Het
Itpr3	A	T	17: 27,110,921	Q1563L	possibly damaging	Het
Kctd16	A	G	18: 40,530,829	N337S	probably benign	Het
Klra4	C	T	6: 130,053,053	V190M	possibly damaging	Het
Krtap4-9	T	A	11: 99,785,636		probably benign	Het
L3mbtl1	GGCCG	GG	2: 162,967,336		probably benign	Het
Mchr1	T	C	15: 81,237,843	F265L	probably damaging	Het
Megf8	T	A	7: 25,326,441	Y83*	probably null	Het
Mettl18	A	G	1: 163,997,177	M356V	probably null	Het
Mrm1	G	A	11: 84,819,192	R61W	probably damaging	Het
Muc4	A	T	16: 32,751,705	T528S	probably benign	Het
Myef2	A	T	2: 125,095,731	L530*	probably null	Het
Nhlrc4	T	C	17: 25,943,719	E18G	probably benign	Het
Nisch	C	T	14: 31,173,145	V1065I	probably benign	Het
Nlgn2	C	T	11: 69,834,149	R97H	probably damaging	Het
Nos2	T	C	11: 78,937,915	L321S	probably damaging	Het
Oaz3	T	C	3: 94,436,410	M49V	possibly damaging	Het
Olfm5	A	G	7: 104,154,155	V367A	probably damaging	Het
Olfr130	C	A	17: 38,067,750	A193D	probably benign	Het
Olfr1335	C	T	4: 118,809,378	R162H	probably benign	Het
Olfr564	A	T	7: 102,804,274	R265S	probably damaging	Het
Olfr742	C	A	14: 50,515,792	A196D	probably benign	Het
Olfr77	A	G	9: 19,920,910	K234E	probably damaging	Het
Omd	C	T	13: 49,589,636	P54L	possibly damaging	Het
Pard3b	T	A	1: 61,768,130		probably benign	Het
Pcdhb18	A	C	18: 37,491,935	I773L	possibly damaging	Het
Pde11a	T	C	2: 76,139,831		probably null	Het
Pfkfb4	A	C	9: 109,030,394		probably benign	Het
Phb2	T	G	6: 124,715,649	I260S	probably damaging	Het
Pkd1l1	G	A	11: 8,958,969	T345I	unknown	Het
Pla2g6	T	C	15: 79,303,528		probably benign	Het
Pou4f2	G	A	8: 78,436,391	S5F	unknown	Het
Ppp1r9a	A	T	6: 5,157,002		probably null	Het
Pramel5	A	G	4: 144,272,983	I178T	probably benign	Het
Prom2	C	T	2: 127,530,133	W745*	probably null	Het
Pros1	T	A	16: 62,928,061	N632K	probably damaging	Het
Rab4b	A	G	7: 27,174,502	I117T	probably benign	Het
Rbm25	T	A	12: 83,677,866	H796Q	possibly damaging	Het
Rnf151	A	T	17: 24,718,030		probably null	Het
Rps6ka1	A	T	4: 133,871,571	L97I	probably damaging	Het
Sergef	T	A	7: 46,443,464	T374S	probably benign	Het
Sh3rf3	G	T	10: 59,130,986	G717C	probably damaging	Het
Slc29a4	C	T	5: 142,721,402	T500I	possibly damaging	Het
Smc1b	T	A	15: 85,086,121	D977V	probably damaging	Het
Spata31d1d	C	T	13: 59,727,015	C902Y	probably benign	Het
Stat3	A	T	11: 100,893,670	I602N	possibly damaging	Het
Stx4a	T	A	7: 127,846,489	I189N	probably damaging	Het
Tacc1	A	G	8: 25,182,199	S338P	probably benign	Het
Tcirg1	T	A	19: 3,902,424	T315S	possibly damaging	Het
Tenm4	A	T	7: 96,854,719	N1295I	probably damaging	Het
Tm7sf3	T	C	6: 146,603,911	K516E	possibly damaging	Het
Tmem198b	T	C	10: 128,801,454	E272G	possibly damaging	Het
Tnip3	A	G	6: 65,605,953	Q237R	probably damaging	Het
Trim15	C	T	17: 36,862,360		probably null	Het
Trim30a	T	A	7: 104,421,450	N252I	possibly damaging	Het
Ttc39a	A	G	4: 109,430,878	E227G	probably benign	Het
Ttll13	A	G	7: 80,253,166	E194G	probably damaging	Het
Upf1	G	A	8: 70,344,262	T107I	probably benign	Het
Vac14	A	G	8: 110,710,349	I565V	probably damaging	Het
Zcchc14	A	T	8: 121,611,358		probably benign	Het

Other mutations in St14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:St14	APN	9	31103779	missense	probably damaging	1.00
IGL01443:St14	APN	9	31100193	nonsense	probably null
IGL01816:St14	APN	9	31108267	missense	possibly damaging	0.71
IGL02100:St14	APN	9	31100130	splice site	probably benign
IGL02494:St14	APN	9	31108645	missense	possibly damaging	0.47
IGL02588:St14	APN	9	31090033	splice site	probably benign
IGL02663:St14	APN	9	31100382	splice site	probably null
IGL02711:St14	APN	9	31089900	missense	probably benign	0.05
IGL03130:St14	APN	9	31097071	critical splice donor site	probably null
IGL03296:St14	APN	9	31108712	missense	probably damaging	0.98
IGL03400:St14	APN	9	31096971	splice site	probably benign
R0101:St14	UTSW	9	31097107	missense	probably benign	0.23
R0225:St14	UTSW	9	31108284	critical splice acceptor site	probably null
R0335:St14	UTSW	9	31091324	splice site	probably benign
R0892:St14	UTSW	9	31100428	missense	probably benign	0.38
R1334:St14	UTSW	9	31108210	missense	probably damaging	1.00
R1487:St14	UTSW	9	31097180	missense	probably damaging	1.00
R1521:St14	UTSW	9	31108215	missense	probably benign	0.03
R1782:St14	UTSW	9	31100164	missense	probably damaging	1.00
R1920:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1921:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1922:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1933:St14	UTSW	9	31106212	missense	probably benign	0.00
R2070:St14	UTSW	9	31091373	missense	probably damaging	1.00
R2411:St14	UTSW	9	31108234	missense	probably benign	0.13
R4152:St14	UTSW	9	31090506	missense	probably benign	0.08
R4375:St14	UTSW	9	31090458	missense	probably benign	0.02
R4419:St14	UTSW	9	31096928	missense	probably damaging	1.00
R4747:St14	UTSW	9	31103757	missense	possibly damaging	0.78
R4791:St14	UTSW	9	31095622	missense	probably benign	0.27
R4915:St14	UTSW	9	31108664	nonsense	probably null
R5056:St14	UTSW	9	31097551	splice site	probably null
R5134:St14	UTSW	9	31095583	missense	probably benign	0.00
R5241:St14	UTSW	9	31100418	nonsense	probably null
R5325:St14	UTSW	9	31096978	splice site	probably null
R5644:St14	UTSW	9	31106510	missense	probably benign
R5828:St14	UTSW	9	31091507	missense	probably damaging	1.00
R5922:St14	UTSW	9	31129904	intron	probably benign
R5963:St14	UTSW	9	31106557	intron	probably benign
R6911:St14	UTSW	9	31106785	missense	probably benign	0.00
R6937:St14	UTSW	9	31129660	splice site	probably null
R6986:St14	UTSW	9	31096549	missense	probably damaging	0.98
R7226:St14	UTSW	9	31100152	missense	possibly damaging	0.63
R7395:St14	UTSW	9	31096899	missense	probably benign	0.29
R7400:St14	UTSW	9	31108275	missense	probably benign	0.36
R8194:St14	UTSW	9	31131625	start codon destroyed	probably null	0.95
R8886:St14	UTSW	9	31097124	missense	possibly damaging	0.93
R9248:St14	UTSW	9	31091609	missense	probably damaging	1.00
R9440:St14	UTSW	9	31096549	missense	probably damaging	0.98
Z1177:St14	UTSW	9	31090507	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGTCTACAGAAAGGCCAGTC -3'
(R):5'- TGAAGGCCTTTTCCACCCTG -3'

Sequencing Primer
(F):5'- AGTCTGCCAACCTCCTGAG -3'
(R):5'- GTGTTCAGGTCCAGGGTTAGGAG -3'

Posted On

2017-02-28