Incidental Mutation 'R0563:Olfr1357'
ID46019
Institutional Source Beutler Lab
Gene Symbol Olfr1357
Ensembl Gene ENSMUSG00000071185
Gene Nameolfactory receptor 1357
SynonymsMOR128-4, GA_x6K02T2QGN0-3196801-3197742, MOR128-3
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78611003-78618074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78612633 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 3 (P3S)
Ref Sequence ENSEMBL: ENSMUSP00000150167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095473] [ENSMUST00000203305] [ENSMUST00000205085] [ENSMUST00000213877]
Predicted Effect probably benign
Transcript: ENSMUST00000095473
AA Change: P3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093127
Gene: ENSMUSG00000071185
AA Change: P3S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203305
AA Change: P3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145032
Gene: ENSMUSG00000071185
AA Change: P3S

DomainStartEndE-ValueType
Pfam:7tm_4 31 235 1.3e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 215 7.7e-11 PFAM
Pfam:7tm_1 41 234 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205085
AA Change: P3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145185
Gene: ENSMUSG00000071185
AA Change: P3S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213877
AA Change: P3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Olfr1357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Olfr1357 APN 10 78612126 missense probably benign 0.02
IGL02201:Olfr1357 APN 10 78612270 missense probably damaging 0.96
IGL03029:Olfr1357 APN 10 78611958 missense probably benign 0.14
IGL03094:Olfr1357 APN 10 78612119 missense possibly damaging 0.80
R0207:Olfr1357 UTSW 10 78611871 missense probably benign
R0745:Olfr1357 UTSW 10 78612122 missense probably benign 0.02
R1607:Olfr1357 UTSW 10 78612140 missense probably benign 0.08
R2419:Olfr1357 UTSW 10 78612387 missense probably benign 0.34
R4198:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4199:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4200:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4619:Olfr1357 UTSW 10 78612575 missense probably benign
R6152:Olfr1357 UTSW 10 78612575 missense probably benign
R6836:Olfr1357 UTSW 10 78612590 missense probably damaging 1.00
R6843:Olfr1357 UTSW 10 78612057 missense probably damaging 1.00
R7266:Olfr1357 UTSW 10 78612614 missense probably benign 0.07
Z1176:Olfr1357 UTSW 10 78612056 missense probably damaging 1.00
Z1177:Olfr1357 UTSW 10 78612151 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGCCTGTGAAAGAGATAGCTCTGC -3'
(R):5'- CTTGGAGAACATGAAAACCACTGGAGAT -3'

Sequencing Primer
(F):5'- GTTCACTAGCATCTTGGGAACAG -3'
(R):5'- TGAAAACCACTGGAGATAGCTTAAAG -3'
Posted On2013-06-11