Incidental Mutation 'R5930:Itpr3'
ID460217
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
MMRRC Submission 044125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5930 (G1)
Quality Score207
Status Validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27110921 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1563 (Q1563L)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049308
AA Change: Q1563L

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Q1563L

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Meta Mutation Damage Score 0.2642 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,397,451 V5572I probably benign Het
AF366264 T A 8: 13,837,263 D276V probably benign Het
Agap1 C T 1: 89,843,096 T656I probably damaging Het
Als2cl C T 9: 110,887,364 R247W probably damaging Het
Ankfy1 A T 11: 72,712,245 R33S probably benign Het
Ano5 T C 7: 51,585,331 F671L probably damaging Het
Arhgap26 A G 18: 39,150,092 M361V probably damaging Het
Bckdk A G 7: 127,905,973 E175G probably damaging Het
Bptf G T 11: 107,073,196 T1724K probably damaging Het
Btn2a2 T A 13: 23,486,228 I112F probably damaging Het
Cd163l1 C T 7: 140,230,446 P984S probably benign Het
Cln8 T A 8: 14,896,621 W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 E300G probably benign Het
Cnksr3 T C 10: 7,142,993 I173V probably benign Het
Cntn2 T A 1: 132,523,432 D484V probably damaging Het
Cyp4a14 C A 4: 115,491,410 G319V probably damaging Het
Cyp4f37 G A 17: 32,629,983 R275Q possibly damaging Het
Def8 C T 8: 123,460,070 probably benign Het
Dnah10 T C 5: 124,791,791 probably null Het
Dock6 A G 9: 21,824,416 V1012A probably benign Het
Dus3l T A 17: 56,769,579 N586K probably damaging Het
Dyrk2 T A 10: 118,860,268 I362F probably damaging Het
Dyx1c1 T C 9: 72,971,998 V356A probably damaging Het
Erc2 T A 14: 27,776,858 D230E probably damaging Het
Fam102b A T 3: 108,980,152 S265R probably benign Het
Fat1 A G 8: 45,044,036 H4186R probably benign Het
Fbxo44 A G 4: 148,156,595 F179S probably damaging Het
Fech A G 18: 64,478,649 probably null Het
Fer1l5 T A 1: 36,385,173 C289* probably null Het
Fhl5 T A 4: 25,214,756 D7V probably benign Het
Flvcr1 G T 1: 191,009,551 T514K probably damaging Het
Fmo1 A T 1: 162,839,616 probably null Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gli3 A G 13: 15,548,625 Y117C probably damaging Het
Gnao1 A G 8: 93,896,245 D59G probably benign Het
Gria2 T C 3: 80,707,249 I495V possibly damaging Het
Hnf1b C A 11: 83,863,985 H161Q probably benign Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Kctd16 A G 18: 40,530,829 N337S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Krtap4-9 T A 11: 99,785,636 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Mchr1 T C 15: 81,237,843 F265L probably damaging Het
Megf8 T A 7: 25,326,441 Y83* probably null Het
Mettl18 A G 1: 163,997,177 M356V probably null Het
Mrm1 G A 11: 84,819,192 R61W probably damaging Het
Muc4 A T 16: 32,751,705 T528S probably benign Het
Myef2 A T 2: 125,095,731 L530* probably null Het
Nhlrc4 T C 17: 25,943,719 E18G probably benign Het
Nisch C T 14: 31,173,145 V1065I probably benign Het
Nlgn2 C T 11: 69,834,149 R97H probably damaging Het
Nos2 T C 11: 78,937,915 L321S probably damaging Het
Oaz3 T C 3: 94,436,410 M49V possibly damaging Het
Olfm5 A G 7: 104,154,155 V367A probably damaging Het
Olfr130 C A 17: 38,067,750 A193D probably benign Het
Olfr1335 C T 4: 118,809,378 R162H probably benign Het
Olfr564 A T 7: 102,804,274 R265S probably damaging Het
Olfr742 C A 14: 50,515,792 A196D probably benign Het
Olfr77 A G 9: 19,920,910 K234E probably damaging Het
Omd C T 13: 49,589,636 P54L possibly damaging Het
Pard3b T A 1: 61,768,130 probably benign Het
Pcdhb18 A C 18: 37,491,935 I773L possibly damaging Het
Pde11a T C 2: 76,139,831 probably null Het
Pfkfb4 A C 9: 109,030,394 probably benign Het
Phb2 T G 6: 124,715,649 I260S probably damaging Het
Pkd1l1 G A 11: 8,958,969 T345I unknown Het
Pla2g6 T C 15: 79,303,528 probably benign Het
Pou4f2 G A 8: 78,436,391 S5F unknown Het
Ppp1r9a A T 6: 5,157,002 probably null Het
Pramel5 A G 4: 144,272,983 I178T probably benign Het
Prom2 C T 2: 127,530,133 W745* probably null Het
Pros1 T A 16: 62,928,061 N632K probably damaging Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rbm25 T A 12: 83,677,866 H796Q possibly damaging Het
Rnf151 A T 17: 24,718,030 probably null Het
Rps6ka1 A T 4: 133,871,571 L97I probably damaging Het
Sergef T A 7: 46,443,464 T374S probably benign Het
Sh3rf3 G T 10: 59,130,986 G717C probably damaging Het
Slc29a4 C T 5: 142,721,402 T500I possibly damaging Het
Smc1b T A 15: 85,086,121 D977V probably damaging Het
Spata31d1d C T 13: 59,727,015 C902Y probably benign Het
St14 A T 9: 31,103,760 V314D probably damaging Het
Stat3 A T 11: 100,893,670 I602N possibly damaging Het
Stx4a T A 7: 127,846,489 I189N probably damaging Het
Tacc1 A G 8: 25,182,199 S338P probably benign Het
Tcirg1 T A 19: 3,902,424 T315S possibly damaging Het
Tenm4 A T 7: 96,854,719 N1295I probably damaging Het
Tm7sf3 T C 6: 146,603,911 K516E possibly damaging Het
Tmem198b T C 10: 128,801,454 E272G possibly damaging Het
Tnip3 A G 6: 65,605,953 Q237R probably damaging Het
Trim15 C T 17: 36,862,360 probably null Het
Trim30a T A 7: 104,421,450 N252I possibly damaging Het
Ttc39a A G 4: 109,430,878 E227G probably benign Het
Ttll13 A G 7: 80,253,166 E194G probably damaging Het
Upf1 G A 8: 70,344,262 T107I probably benign Het
Vac14 A G 8: 110,710,349 I565V probably damaging Het
Zcchc14 A T 8: 121,611,358 probably benign Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGACTGCAAAGGATCAGGC -3'
(R):5'- GTGTCCAACCAAGAAGCAGC -3'

Sequencing Primer
(F):5'- AGATTCCTTGTGTGCCTACCAGG -3'
(R):5'- ACCAAGAAGCAGCAACTCTG -3'
Posted On2017-02-28