Mutagenetix > Incidental Mutations

Incidental Mutation 'R5930:Arhgap26'

460223

Institutional Source

Beutler Lab

Gene Symbol

Arhgap26

Ensembl Gene

ENSMUSG00000036452

Gene Name

Rho GTPase activating protein 26

Synonyms

2610010G17Rik, 1810044B20Rik, 4933432P15Rik

MMRRC Submission

044125-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38601534-39376284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39150092 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 361 (M361V)

Ref Sequence

ENSEMBL: ENSMUSP00000095200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000155576]

Predicted Effect

probably damaging
Transcript: ENSMUST00000097593
AA Change: M361V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: M361V

Domain	Start	End	E-Value	Type
Pfam:BAR_3	6	249	1.8e-90	PFAM
Pfam:IMD	26	231	2.8e-9	PFAM
PH	266	371	3.23e-8	SMART
RhoGAP	387	565	4.51e-65	SMART
low complexity region	584	600	N/A	INTRINSIC
low complexity region	617	652	N/A	INTRINSIC
low complexity region	657	701	N/A	INTRINSIC
SH3	759	814	5.11e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155576
AA Change: M361V

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: M361V

Domain	Start	End	E-Value	Type
Pfam:IMD	27	232	1.2e-8	PFAM
PH	266	371	3.23e-8	SMART
RhoGAP	387	565	4.51e-65	SMART
low complexity region	584	600	N/A	INTRINSIC
low complexity region	617	652	N/A	INTRINSIC
low complexity region	657	702	N/A	INTRINSIC
SH3	704	759	5.11e-14	SMART

Meta Mutation Damage Score

0.2540

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

94% (102/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,397,451	V5572I	probably benign	Het
AF366264	T	A	8: 13,837,263	D276V	probably benign	Het
Agap1	C	T	1: 89,843,096	T656I	probably damaging	Het
Als2cl	C	T	9: 110,887,364	R247W	probably damaging	Het
Ankfy1	A	T	11: 72,712,245	R33S	probably benign	Het
Ano5	T	C	7: 51,585,331	F671L	probably damaging	Het
Bckdk	A	G	7: 127,905,973	E175G	probably damaging	Het
Bptf	G	T	11: 107,073,196	T1724K	probably damaging	Het
Btn2a2	T	A	13: 23,486,228	I112F	probably damaging	Het
Cd163l1	C	T	7: 140,230,446	P984S	probably benign	Het
Cln8	T	A	8: 14,896,621	W212R	probably damaging	Het
Cnbd1	T	C	4: 18,886,119	E300G	probably benign	Het
Cnksr3	T	C	10: 7,142,993	I173V	probably benign	Het
Cntn2	T	A	1: 132,523,432	D484V	probably damaging	Het
Cyp4a14	C	A	4: 115,491,410	G319V	probably damaging	Het
Cyp4f37	G	A	17: 32,629,983	R275Q	possibly damaging	Het
Def8	C	T	8: 123,460,070		probably benign	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Dock6	A	G	9: 21,824,416	V1012A	probably benign	Het
Dus3l	T	A	17: 56,769,579	N586K	probably damaging	Het
Dyrk2	T	A	10: 118,860,268	I362F	probably damaging	Het
Dyx1c1	T	C	9: 72,971,998	V356A	probably damaging	Het
Erc2	T	A	14: 27,776,858	D230E	probably damaging	Het
Fam102b	A	T	3: 108,980,152	S265R	probably benign	Het
Fat1	A	G	8: 45,044,036	H4186R	probably benign	Het
Fbxo44	A	G	4: 148,156,595	F179S	probably damaging	Het
Fech	A	G	18: 64,478,649		probably null	Het
Fer1l5	T	A	1: 36,385,173	C289*	probably null	Het
Fhl5	T	A	4: 25,214,756	D7V	probably benign	Het
Flvcr1	G	T	1: 191,009,551	T514K	probably damaging	Het
Fmo1	A	T	1: 162,839,616		probably null	Het
Gabra6	G	A	11: 42,307,441	T384M	probably benign	Het
Gli3	A	G	13: 15,548,625	Y117C	probably damaging	Het
Gnao1	A	G	8: 93,896,245	D59G	probably benign	Het
Gria2	T	C	3: 80,707,249	I495V	possibly damaging	Het
Hnf1b	C	A	11: 83,863,985	H161Q	probably benign	Het
Itga8	T	A	2: 12,230,208	D413V	possibly damaging	Het
Itpr3	A	T	17: 27,110,921	Q1563L	possibly damaging	Het
Kctd16	A	G	18: 40,530,829	N337S	probably benign	Het
Klra4	C	T	6: 130,053,053	V190M	possibly damaging	Het
Krtap4-9	T	A	11: 99,785,636		probably benign	Het
L3mbtl1	GGCCG	GG	2: 162,967,336		probably benign	Het
Mchr1	T	C	15: 81,237,843	F265L	probably damaging	Het
Megf8	T	A	7: 25,326,441	Y83*	probably null	Het
Mettl18	A	G	1: 163,997,177	M356V	probably null	Het
Mrm1	G	A	11: 84,819,192	R61W	probably damaging	Het
Muc4	A	T	16: 32,751,705	T528S	probably benign	Het
Myef2	A	T	2: 125,095,731	L530*	probably null	Het
Nhlrc4	T	C	17: 25,943,719	E18G	probably benign	Het
Nisch	C	T	14: 31,173,145	V1065I	probably benign	Het
Nlgn2	C	T	11: 69,834,149	R97H	probably damaging	Het
Nos2	T	C	11: 78,937,915	L321S	probably damaging	Het
Oaz3	T	C	3: 94,436,410	M49V	possibly damaging	Het
Olfm5	A	G	7: 104,154,155	V367A	probably damaging	Het
Olfr130	C	A	17: 38,067,750	A193D	probably benign	Het
Olfr1335	C	T	4: 118,809,378	R162H	probably benign	Het
Olfr564	A	T	7: 102,804,274	R265S	probably damaging	Het
Olfr742	C	A	14: 50,515,792	A196D	probably benign	Het
Olfr77	A	G	9: 19,920,910	K234E	probably damaging	Het
Omd	C	T	13: 49,589,636	P54L	possibly damaging	Het
Pard3b	T	A	1: 61,768,130		probably benign	Het
Pcdhb18	A	C	18: 37,491,935	I773L	possibly damaging	Het
Pde11a	T	C	2: 76,139,831		probably null	Het
Pfkfb4	A	C	9: 109,030,394		probably benign	Het
Phb2	T	G	6: 124,715,649	I260S	probably damaging	Het
Pkd1l1	G	A	11: 8,958,969	T345I	unknown	Het
Pla2g6	T	C	15: 79,303,528		probably benign	Het
Pou4f2	G	A	8: 78,436,391	S5F	unknown	Het
Ppp1r9a	A	T	6: 5,157,002		probably null	Het
Pramel5	A	G	4: 144,272,983	I178T	probably benign	Het
Prom2	C	T	2: 127,530,133	W745*	probably null	Het
Pros1	T	A	16: 62,928,061	N632K	probably damaging	Het
Rab4b	A	G	7: 27,174,502	I117T	probably benign	Het
Rbm25	T	A	12: 83,677,866	H796Q	possibly damaging	Het
Rnf151	A	T	17: 24,718,030		probably null	Het
Rps6ka1	A	T	4: 133,871,571	L97I	probably damaging	Het
Sergef	T	A	7: 46,443,464	T374S	probably benign	Het
Sh3rf3	G	T	10: 59,130,986	G717C	probably damaging	Het
Slc29a4	C	T	5: 142,721,402	T500I	possibly damaging	Het
Smc1b	T	A	15: 85,086,121	D977V	probably damaging	Het
Spata31d1d	C	T	13: 59,727,015	C902Y	probably benign	Het
St14	A	T	9: 31,103,760	V314D	probably damaging	Het
Stat3	A	T	11: 100,893,670	I602N	possibly damaging	Het
Stx4a	T	A	7: 127,846,489	I189N	probably damaging	Het
Tacc1	A	G	8: 25,182,199	S338P	probably benign	Het
Tcirg1	T	A	19: 3,902,424	T315S	possibly damaging	Het
Tenm4	A	T	7: 96,854,719	N1295I	probably damaging	Het
Tm7sf3	T	C	6: 146,603,911	K516E	possibly damaging	Het
Tmem198b	T	C	10: 128,801,454	E272G	possibly damaging	Het
Tnip3	A	G	6: 65,605,953	Q237R	probably damaging	Het
Trim15	C	T	17: 36,862,360		probably null	Het
Trim30a	T	A	7: 104,421,450	N252I	possibly damaging	Het
Ttc39a	A	G	4: 109,430,878	E227G	probably benign	Het
Ttll13	A	G	7: 80,253,166	E194G	probably damaging	Het
Upf1	G	A	8: 70,344,262	T107I	probably benign	Het
Vac14	A	G	8: 110,710,349	I565V	probably damaging	Het
Zcchc14	A	T	8: 121,611,358		probably benign	Het

Other mutations in Arhgap26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Arhgap26	APN	18	39286551	missense	probably damaging	1.00
IGL01116:Arhgap26	APN	18	39111803	missense	probably damaging	0.97
IGL01409:Arhgap26	APN	18	39110451	splice site	probably benign
IGL02316:Arhgap26	APN	18	38642546	exon	noncoding transcript
IGL02418:Arhgap26	APN	18	39357567	intron	probably benign
IGL02588:Arhgap26	APN	18	38601617	unclassified	probably benign
IGL03241:Arhgap26	APN	18	39229917	missense	probably damaging	1.00
R0184:Arhgap26	UTSW	18	38617673	missense	unknown
R0244:Arhgap26	UTSW	18	39363131	missense	probably benign	0.05
R0347:Arhgap26	UTSW	18	38617744	missense	unknown
R1533:Arhgap26	UTSW	18	39371077	missense	probably benign	0.16
R1606:Arhgap26	UTSW	18	39296872	missense	probably damaging	1.00
R2066:Arhgap26	UTSW	18	39306728	missense	probably damaging	1.00
R2182:Arhgap26	UTSW	18	39357809	intron	probably benign
R2291:Arhgap26	UTSW	18	39357698	intron	probably benign
R3611:Arhgap26	UTSW	18	38933919	missense	probably benign
R3700:Arhgap26	UTSW	18	39120184	missense	probably damaging	0.99
R3887:Arhgap26	UTSW	18	39229966	critical splice donor site	probably null
R4621:Arhgap26	UTSW	18	38899841	intron	probably benign
R4877:Arhgap26	UTSW	18	39296929	splice site	probably null
R4910:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4911:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4954:Arhgap26	UTSW	18	39243641	missense	probably benign	0.00
R4967:Arhgap26	UTSW	18	39246840	missense	probably damaging	1.00
R5221:Arhgap26	UTSW	18	39110472	nonsense	probably null
R5232:Arhgap26	UTSW	18	38993476	start codon destroyed	probably null	0.97
R5297:Arhgap26	UTSW	18	39121888	missense	probably damaging	1.00
R5372:Arhgap26	UTSW	18	38642456	exon	noncoding transcript
R5570:Arhgap26	UTSW	18	39099618	missense	probably damaging	0.99
R5692:Arhgap26	UTSW	18	39121892	missense	probably damaging	1.00
R5752:Arhgap26	UTSW	18	39286672	missense	probably damaging	1.00
R6131:Arhgap26	UTSW	18	39286585	nonsense	probably null
R6251:Arhgap26	UTSW	18	39357827	missense	probably null
R6481:Arhgap26	UTSW	18	39150057	missense	probably damaging	1.00
R6622:Arhgap26	UTSW	18	38899863	intron	probably benign
R6799:Arhgap26	UTSW	18	39099607	missense	probably damaging	1.00
R6878:Arhgap26	UTSW	18	39227412	missense	probably damaging	1.00
R6989:Arhgap26	UTSW	18	39099629	missense	probably damaging	1.00
R7248:Arhgap26	UTSW	18	39306854	critical splice donor site	probably null
R7936:Arhgap26	UTSW	18	39205287	missense	probably damaging	1.00
R7960:Arhgap26	UTSW	18	39229927	missense
R8103:Arhgap26	UTSW	18	39371124	missense
R8206:Arhgap26	UTSW	18	39306750	nonsense	probably null
R8356:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8456:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8987:Arhgap26	UTSW	18	39357599	missense
R9025:Arhgap26	UTSW	18	39246845	missense
X0013:Arhgap26	UTSW	18	39371112	missense	probably damaging	1.00
X0025:Arhgap26	UTSW	18	39150105	missense	probably damaging	1.00
Z1088:Arhgap26	UTSW	18	39357671	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCATTCTCTCCCACTGATAAC -3'
(R):5'- TTAGGAGCCAAGGCCAAAAC -3'

Sequencing Primer
(F):5'- TCCCACTGATAACTGGATATGTC -3'
(R):5'- CGGGAGCTACATCTACACAG -3'

Posted On

2017-02-28