Incidental Mutation 'R5941:Alpk3'
ID 460259
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
MMRRC Submission 044133-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R5941 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80707348-80755360 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80728401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 510 (K510N)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107348
AA Change: K510N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: K510N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,190,321 (GRCm39) D70E probably damaging Het
Adamts14 C T 10: 61,057,674 (GRCm39) G561R probably damaging Het
Ap3b1 A G 13: 94,576,781 (GRCm39) N269D probably benign Het
Ap3b1 T C 13: 94,619,773 (GRCm39) S144P probably damaging Het
Apba2 C A 7: 64,395,464 (GRCm39) Q635K probably benign Het
Aspg C T 12: 112,079,519 (GRCm39) T99I probably benign Het
Atp7b A G 8: 22,487,512 (GRCm39) V1179A probably damaging Het
Bbs12 T C 3: 37,374,197 (GRCm39) V215A probably damaging Het
Bcl2l11 C A 2: 127,969,703 (GRCm39) probably benign Het
Bglap3 T G 3: 88,283,653 (GRCm39) probably benign Het
Cchcr1 G A 17: 35,835,890 (GRCm39) R284Q probably damaging Het
Cdh26 C T 2: 178,123,443 (GRCm39) Q662* probably null Het
Cftr T A 6: 18,313,645 (GRCm39) F1290I probably damaging Het
Clip3 G A 7: 29,991,731 (GRCm39) E36K probably damaging Het
Cog2 A G 8: 125,272,825 (GRCm39) I541V probably benign Het
Cpt1b A T 15: 89,309,417 (GRCm39) W39R probably damaging Het
Csmd1 A G 8: 15,982,471 (GRCm39) V2732A probably damaging Het
Dlec1 A G 9: 118,955,380 (GRCm39) D688G probably damaging Het
Dnah12 A G 14: 26,428,022 (GRCm39) E216G probably benign Het
Dnah7b C A 1: 46,226,450 (GRCm39) L1294I probably damaging Het
Duox1 T A 2: 122,174,637 (GRCm39) L1265Q probably damaging Het
Fam91a1 T A 15: 58,303,166 (GRCm39) D358E probably benign Het
Fat3 A C 9: 15,910,797 (GRCm39) I1735S probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Gabrr1 T A 4: 33,162,676 (GRCm39) M414K probably benign Het
Gm21915 A C 9: 40,581,995 (GRCm39) E29D possibly damaging Het
Gm9955 G A 18: 24,842,320 (GRCm39) probably benign Het
Gpat2 C A 2: 127,270,195 (GRCm39) D69E possibly damaging Het
Grin2b T G 6: 135,713,371 (GRCm39) I837L probably damaging Het
Gucy2g T C 19: 55,203,563 (GRCm39) D745G probably damaging Het
H2-Q1 A G 17: 35,540,332 (GRCm39) Y139C probably damaging Het
Ints2 G C 11: 86,141,798 (GRCm39) N216K probably benign Het
Jmy G A 13: 93,635,333 (GRCm39) P161L probably benign Het
Kctd11 G A 11: 69,770,799 (GRCm39) R80W possibly damaging Het
Kif7 A G 7: 79,360,880 (GRCm39) probably benign Het
Kifc1 C T 17: 34,102,059 (GRCm39) probably benign Het
Lcor G A 19: 41,574,839 (GRCm39) R1198Q probably damaging Het
Mir412 C A 12: 109,709,733 (GRCm39) noncoding transcript Het
Mknk1 T A 4: 115,733,834 (GRCm39) probably benign Het
Mmp16 A G 4: 18,054,354 (GRCm39) probably benign Het
Mmp7 A G 9: 7,697,646 (GRCm39) H227R probably damaging Het
Myh4 A C 11: 67,150,126 (GRCm39) D1861A probably damaging Het
Nup205 T C 6: 35,209,343 (GRCm39) L1550P probably damaging Het
Or10g1 C T 14: 52,647,525 (GRCm39) G268D probably benign Het
Or2a56 G T 6: 42,932,650 (GRCm39) A73S possibly damaging Het
Or4c113 T A 2: 88,884,963 (GRCm39) H269L probably benign Het
Or4c58 T A 2: 89,674,859 (GRCm39) I153F probably benign Het
Or51af1 A G 7: 103,141,927 (GRCm39) S53P possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pafah1b2 A T 9: 45,887,405 (GRCm39) C35* probably null Het
Pappa T A 4: 65,232,830 (GRCm39) F1323Y possibly damaging Het
Phtf2 A T 5: 20,979,071 (GRCm39) F519Y probably damaging Het
Pigk T C 3: 152,472,150 (GRCm39) I354T possibly damaging Het
Plekha7 T C 7: 115,724,040 (GRCm39) D1265G possibly damaging Het
Prss12 A G 3: 123,299,150 (GRCm39) R641G probably benign Het
Prss28 A G 17: 25,528,717 (GRCm39) Y53C probably damaging Het
Rabgap1 G T 2: 37,451,908 (GRCm39) C936F possibly damaging Het
Rap1a T C 3: 105,639,385 (GRCm39) I91M possibly damaging Het
Rap1gap2 A T 11: 74,283,063 (GRCm39) M679K probably damaging Het
Rapgef5 T A 12: 117,692,473 (GRCm39) L352I probably damaging Het
Rhbdl3 G A 11: 80,222,715 (GRCm39) V255M probably benign Het
Rhot1 T C 11: 80,141,996 (GRCm39) probably benign Het
Rita1 A C 5: 120,747,626 (GRCm39) V224G probably benign Het
Ryr2 T A 13: 11,702,788 (GRCm39) Y2900F probably damaging Het
Scaf11 A C 15: 96,318,189 (GRCm39) H458Q probably damaging Het
Scamp4 T A 10: 80,448,255 (GRCm39) S159T probably benign Het
Setd5 T A 6: 113,105,451 (GRCm39) Y828N probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Sipa1l2 A G 8: 126,200,275 (GRCm39) S684P probably damaging Het
Stard9 A T 2: 120,544,039 (GRCm39) I4446F probably damaging Het
Sult1c2 T C 17: 54,138,926 (GRCm39) D217G probably benign Het
Supt16 C A 14: 52,419,653 (GRCm39) K148N probably benign Het
Syne3 G A 12: 104,913,251 (GRCm39) S570L probably benign Het
Tcf3 G T 10: 80,248,878 (GRCm39) D534E probably benign Het
Tmed6 G T 8: 107,790,786 (GRCm39) T87K probably damaging Het
Trbv3 T C 6: 41,025,335 (GRCm39) I3T probably benign Het
Trbv4 T A 6: 41,036,563 (GRCm39) Y29* probably null Het
Ttl A G 2: 128,917,904 (GRCm39) N122S probably benign Het
Txndc11 T C 16: 10,892,935 (GRCm39) T932A probably benign Het
Ube2e2 G A 14: 18,586,910 (GRCm38) A150V probably damaging Het
Ube2ql1 T C 13: 69,887,459 (GRCm39) M1V probably null Het
Uqcrc1 A G 9: 108,776,554 (GRCm39) probably benign Het
Utrn T C 10: 12,362,227 (GRCm39) D2702G probably damaging Het
Vcan T A 13: 89,840,810 (GRCm39) D618V probably damaging Het
Vdac3-ps1 A G 13: 18,205,787 (GRCm39) noncoding transcript Het
Wee1 TCCCC TCCC 7: 109,723,776 (GRCm39) probably null Het
Zap70 G A 1: 36,810,030 (GRCm39) V47M probably damaging Het
Zfp770 A G 2: 114,028,027 (GRCm39) M14T possibly damaging Het
Zup1 C T 10: 33,825,458 (GRCm39) G8D probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 80,727,757 (GRCm39) missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 80,745,401 (GRCm39) splice site probably benign
IGL01732:Alpk3 APN 7 80,707,390 (GRCm39) missense unknown
IGL01750:Alpk3 APN 7 80,742,030 (GRCm39) missense probably damaging 1.00
IGL01812:Alpk3 APN 7 80,749,950 (GRCm39) missense probably damaging 1.00
IGL02224:Alpk3 APN 7 80,726,616 (GRCm39) splice site probably benign
IGL02292:Alpk3 APN 7 80,727,653 (GRCm39) missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 80,728,255 (GRCm39) missense probably benign 0.03
IGL02517:Alpk3 APN 7 80,727,643 (GRCm39) missense probably benign 0.00
IGL02725:Alpk3 APN 7 80,743,358 (GRCm39) missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 80,743,507 (GRCm39) missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 80,728,352 (GRCm39) missense probably benign 0.00
IGL03102:Alpk3 APN 7 80,744,804 (GRCm39) critical splice donor site probably null
IGL03153:Alpk3 APN 7 80,743,143 (GRCm39) missense probably benign 0.00
IGL03255:Alpk3 APN 7 80,742,310 (GRCm39) missense probably benign 0.01
IGL03367:Alpk3 APN 7 80,744,738 (GRCm39) missense probably benign 0.01
FR4304:Alpk3 UTSW 7 80,727,510 (GRCm39) small insertion probably benign
FR4737:Alpk3 UTSW 7 80,727,510 (GRCm39) small insertion probably benign
IGL03097:Alpk3 UTSW 7 80,743,657 (GRCm39) missense probably benign 0.00
R0092:Alpk3 UTSW 7 80,742,301 (GRCm39) missense probably benign
R0254:Alpk3 UTSW 7 80,726,722 (GRCm39) missense probably benign 0.43
R0310:Alpk3 UTSW 7 80,728,358 (GRCm39) missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 80,717,701 (GRCm39) missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 80,753,975 (GRCm39) missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 80,742,327 (GRCm39) missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 80,728,348 (GRCm39) missense probably benign
R1146:Alpk3 UTSW 7 80,727,343 (GRCm39) missense probably damaging 0.99
R1146:Alpk3 UTSW 7 80,727,343 (GRCm39) missense probably damaging 0.99
R1168:Alpk3 UTSW 7 80,753,105 (GRCm39) missense probably damaging 1.00
R1306:Alpk3 UTSW 7 80,743,621 (GRCm39) missense probably damaging 1.00
R1822:Alpk3 UTSW 7 80,726,679 (GRCm39) nonsense probably null
R2173:Alpk3 UTSW 7 80,726,648 (GRCm39) missense probably damaging 1.00
R2350:Alpk3 UTSW 7 80,744,718 (GRCm39) missense probably damaging 1.00
R2414:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R2417:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R2885:Alpk3 UTSW 7 80,749,940 (GRCm39) missense probably damaging 1.00
R3004:Alpk3 UTSW 7 80,753,103 (GRCm39) nonsense probably null
R3796:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3797:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3798:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3799:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3894:Alpk3 UTSW 7 80,728,138 (GRCm39) missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 80,744,703 (GRCm39) missense probably damaging 1.00
R4761:Alpk3 UTSW 7 80,753,916 (GRCm39) missense probably damaging 0.99
R5505:Alpk3 UTSW 7 80,728,309 (GRCm39) missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 80,745,184 (GRCm39) missense probably damaging 1.00
R5770:Alpk3 UTSW 7 80,728,310 (GRCm39) missense probably benign 0.02
R5964:Alpk3 UTSW 7 80,742,008 (GRCm39) missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 80,743,005 (GRCm39) missense probably benign 0.34
R6036:Alpk3 UTSW 7 80,743,005 (GRCm39) missense probably benign 0.34
R6066:Alpk3 UTSW 7 80,726,698 (GRCm39) missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 80,728,327 (GRCm39) missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 80,728,432 (GRCm39) missense probably benign 0.00
R7230:Alpk3 UTSW 7 80,743,042 (GRCm39) missense probably damaging 1.00
R7266:Alpk3 UTSW 7 80,742,328 (GRCm39) missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 80,728,202 (GRCm39) missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 80,726,660 (GRCm39) missense probably benign 0.29
R7411:Alpk3 UTSW 7 80,742,600 (GRCm39) missense probably benign 0.11
R7454:Alpk3 UTSW 7 80,728,310 (GRCm39) missense probably benign 0.02
R7468:Alpk3 UTSW 7 80,750,746 (GRCm39) nonsense probably null
R7940:Alpk3 UTSW 7 80,743,693 (GRCm39) missense probably damaging 1.00
R8157:Alpk3 UTSW 7 80,743,470 (GRCm39) missense probably benign 0.00
R8246:Alpk3 UTSW 7 80,742,524 (GRCm39) missense probably benign 0.00
R8357:Alpk3 UTSW 7 80,743,066 (GRCm39) missense probably damaging 1.00
R8444:Alpk3 UTSW 7 80,707,468 (GRCm39) missense probably benign 0.08
R8457:Alpk3 UTSW 7 80,743,066 (GRCm39) missense probably damaging 1.00
R8775:Alpk3 UTSW 7 80,727,598 (GRCm39) missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 80,727,598 (GRCm39) missense probably benign 0.00
R8794:Alpk3 UTSW 7 80,707,403 (GRCm39) missense unknown
R8982:Alpk3 UTSW 7 80,748,750 (GRCm39) missense probably damaging 1.00
R9259:Alpk3 UTSW 7 80,743,302 (GRCm39) missense probably damaging 1.00
R9343:Alpk3 UTSW 7 80,742,079 (GRCm39) missense probably benign 0.27
R9567:Alpk3 UTSW 7 80,742,687 (GRCm39) missense possibly damaging 0.55
R9792:Alpk3 UTSW 7 80,750,881 (GRCm39) critical splice donor site probably null
R9793:Alpk3 UTSW 7 80,750,881 (GRCm39) critical splice donor site probably null
R9798:Alpk3 UTSW 7 80,742,400 (GRCm39) missense probably benign 0.02
RF034:Alpk3 UTSW 7 80,742,162 (GRCm39) small deletion probably benign
RF057:Alpk3 UTSW 7 80,742,165 (GRCm39) frame shift probably null
X0022:Alpk3 UTSW 7 80,743,645 (GRCm39) missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 80,728,374 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGGACATGTTCATGGAGAC -3'
(R):5'- ACCTCTCCTGGAGTCTTGTG -3'

Sequencing Primer
(F):5'- ATGTTCATGGAGACCACCCG -3'
(R):5'- GGCTCGTTTGTCCTTGCAAG -3'
Posted On 2017-02-28