Incidental Mutation 'R0563:Nsd1'
ID46026
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55246578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 767 (T767K)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099490
AA Change: T767K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: T767K

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224973
AA Change: T664K

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
scribe UTSW 13 55291236 missense probably damaging 1.00
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55213374 missense probably benign
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55277639 missense probably damaging 1.00
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGAGCCTGAAACTGCTGAGTTGTC -3'
(R):5'- AGAACGTGCTTCACCACTGCTG -3'

Sequencing Primer
(F):5'- AAACTGCTGAGTTGTCTCAGGTC -3'
(R):5'- GCATATTGTTCAGTAGTTTTAGCCC -3'
Posted On2013-06-11