Incidental Mutation 'R0563:Cwc27'
ID46027
Institutional Source Beutler Lab
Gene Symbol Cwc27
Ensembl Gene ENSMUSG00000021715
Gene NameCWC27 spliceosome-associated protein
Synonyms3110009E13Rik, NY-CO-10, Sdccag10
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104631140-104817142 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 104661357 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 365 (E365*)
Ref Sequence ENSEMBL: ENSMUSP00000022228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022228]
Predicted Effect probably null
Transcript: ENSMUST00000022228
AA Change: E365*
SMART Domains Protein: ENSMUSP00000022228
Gene: ENSMUSG00000021715
AA Change: E365*

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 166 3.4e-47 PFAM
low complexity region 176 197 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
coiled coil region 309 341 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit reduced viability. Surviors after birth show signs of growth retardation and retinal depigmentation, along with numerous neurological, immunological, and blood chemistry abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Cwc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01955:Cwc27 APN 13 104807737 missense probably damaging 1.00
IGL02240:Cwc27 APN 13 104806643 missense probably damaging 0.97
IGL02398:Cwc27 APN 13 104804254 missense possibly damaging 0.82
IGL02620:Cwc27 APN 13 104802206 splice site probably benign
IGL03213:Cwc27 APN 13 104796403 splice site probably benign
pam1 UTSW 13 104661357 nonsense probably null
R0375:Cwc27 UTSW 13 104807823 missense possibly damaging 0.94
R0483:Cwc27 UTSW 13 104811216 critical splice donor site probably null
R0534:Cwc27 UTSW 13 104631616 missense unknown
R0550:Cwc27 UTSW 13 104804949 missense probably damaging 1.00
R0562:Cwc27 UTSW 13 104661357 nonsense probably null
R0564:Cwc27 UTSW 13 104661357 nonsense probably null
R0972:Cwc27 UTSW 13 104661357 nonsense probably null
R1536:Cwc27 UTSW 13 104797306 missense probably damaging 1.00
R1546:Cwc27 UTSW 13 104802185 missense probably damaging 1.00
R1587:Cwc27 UTSW 13 104792637 missense probably benign 0.00
R1934:Cwc27 UTSW 13 104631676 missense probably benign 0.28
R2159:Cwc27 UTSW 13 104804329 missense probably damaging 0.98
R2249:Cwc27 UTSW 13 104631622 missense unknown
R2252:Cwc27 UTSW 13 104631729 missense probably damaging 1.00
R2394:Cwc27 UTSW 13 104796434 missense probably benign 0.01
R2698:Cwc27 UTSW 13 104806751 missense probably damaging 0.99
R3899:Cwc27 UTSW 13 104792515 nonsense probably null
R5121:Cwc27 UTSW 13 104804353 missense probably damaging 1.00
R6317:Cwc27 UTSW 13 104804261 nonsense probably null
R6763:Cwc27 UTSW 13 104811301 missense probably damaging 1.00
R7187:Cwc27 UTSW 13 104661392 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTCACTGCATTCCTCCTTGTG -3'
(R):5'- AGCCTGACAAATTTAGTGCCTGTCAC -3'

Sequencing Primer
(F):5'- gcgagagccacagagcc -3'
(R):5'- GCCTGTCACTTTGTAACCGAG -3'
Posted On2013-06-11