Incidental Mutation 'R5941:Rhbdl3'
ID460287
Institutional Source Beutler Lab
Gene Symbol Rhbdl3
Ensembl Gene ENSMUSG00000017692
Gene Namerhomboid like 3
SynonymsVrho, Ventrhoid, Rhbdl4
MMRRC Submission 044133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5941 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80300912-80355955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80331889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 255 (V255M)
Ref Sequence ENSEMBL: ENSMUSP00000017836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017836]
Predicted Effect probably benign
Transcript: ENSMUST00000017836
AA Change: V255M

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000017836
Gene: ENSMUSG00000017692
AA Change: V255M

DomainStartEndE-ValueType
SCOP:d1c7va_ 36 104 2e-12 SMART
Blast:EFh 38 66 6e-11 BLAST
PDB:2RRT|A 43 102 6e-6 PDB
Blast:EFh 74 102 9e-10 BLAST
transmembrane domain 162 184 N/A INTRINSIC
Pfam:Rhomboid 205 362 1.6e-34 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,591,098 D70E probably damaging Het
Adamts14 C T 10: 61,221,895 G561R probably damaging Het
Alpk3 A T 7: 81,078,653 K510N probably damaging Het
Ap3b1 T C 13: 94,483,265 S144P probably damaging Het
Ap3b1 A G 13: 94,440,273 N269D probably benign Het
Apba2 C A 7: 64,745,716 Q635K probably benign Het
Aspg C T 12: 112,113,085 T99I probably benign Het
Atp7b A G 8: 21,997,496 V1179A probably damaging Het
Bbs12 T C 3: 37,320,048 V215A probably damaging Het
Bcl2l11 C A 2: 128,127,783 probably benign Het
Bglap3 T G 3: 88,376,346 probably benign Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cdh26 C T 2: 178,481,650 Q662* probably null Het
Cftr T A 6: 18,313,646 F1290I probably damaging Het
Clip3 G A 7: 30,292,306 E36K probably damaging Het
Cog2 A G 8: 124,546,086 I541V probably benign Het
Cpt1b A T 15: 89,425,214 W39R probably damaging Het
Csmd1 A G 8: 15,932,471 V2732A probably damaging Het
Dlec1 A G 9: 119,126,312 D688G probably damaging Het
Dnah12 A G 14: 26,706,867 E216G probably benign Het
Dnah7b C A 1: 46,187,290 L1294I probably damaging Het
Duox1 T A 2: 122,344,156 L1265Q probably damaging Het
Fam91a1 T A 15: 58,431,317 D358E probably benign Het
Fat3 A C 9: 15,999,501 I1735S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabrr1 T A 4: 33,162,676 M414K probably benign Het
Gm21915 A C 9: 40,670,699 E29D possibly damaging Het
Gm340 G A 19: 41,586,400 R1198Q probably damaging Het
Gm9955 G A 18: 24,709,263 probably benign Het
Gpat2 C A 2: 127,428,275 D69E possibly damaging Het
Grin2b T G 6: 135,736,373 I837L probably damaging Het
Gucy2g T C 19: 55,215,131 D745G probably damaging Het
H2-Q1 A G 17: 35,321,356 Y139C probably damaging Het
Ints2 G C 11: 86,250,972 N216K probably benign Het
Jmy G A 13: 93,498,825 P161L probably benign Het
Kctd11 G A 11: 69,879,973 R80W possibly damaging Het
Kif7 A G 7: 79,711,132 probably benign Het
Kifc1 C T 17: 33,883,085 probably benign Het
Mir412 C A 12: 109,743,299 noncoding transcript Het
Mknk1 T A 4: 115,876,637 probably benign Het
Mmp16 A G 4: 18,054,354 probably benign Het
Mmp7 A G 9: 7,697,645 H227R probably damaging Het
Myh4 A C 11: 67,259,300 D1861A probably damaging Het
Nup205 T C 6: 35,232,408 L1550P probably damaging Het
Olfr1218 T A 2: 89,054,619 H269L probably benign Het
Olfr1510 C T 14: 52,410,068 G268D probably benign Het
Olfr444 G T 6: 42,955,716 A73S possibly damaging Het
Olfr48 T A 2: 89,844,515 I153F probably benign Het
Olfr609 A G 7: 103,492,720 S53P possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pafah1b2 A T 9: 45,976,107 C35* probably null Het
Pappa T A 4: 65,314,593 F1323Y possibly damaging Het
Phtf2 A T 5: 20,774,073 F519Y probably damaging Het
Pigk T C 3: 152,766,513 I354T possibly damaging Het
Plekha7 T C 7: 116,124,805 D1265G possibly damaging Het
Prss12 A G 3: 123,505,501 R641G probably benign Het
Prss28 A G 17: 25,309,743 Y53C probably damaging Het
Rabgap1 G T 2: 37,561,896 C936F possibly damaging Het
Rap1a T C 3: 105,732,069 I91M possibly damaging Het
Rap1gap2 A T 11: 74,392,237 M679K probably damaging Het
Rapgef5 T A 12: 117,728,738 L352I probably damaging Het
Rhot1 T C 11: 80,251,170 probably benign Het
Rita1 A C 5: 120,609,561 V224G probably benign Het
Ryr2 T A 13: 11,687,902 Y2900F probably damaging Het
Scaf11 A C 15: 96,420,308 H458Q probably damaging Het
Scamp4 T A 10: 80,612,421 S159T probably benign Het
Setd5 T A 6: 113,128,490 Y828N probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sipa1l2 A G 8: 125,473,536 S684P probably damaging Het
Stard9 A T 2: 120,713,558 I4446F probably damaging Het
Sult1c2 T C 17: 53,831,898 D217G probably benign Het
Supt16 C A 14: 52,182,196 K148N probably benign Het
Syne3 G A 12: 104,946,992 S570L probably benign Het
Tcf3 G T 10: 80,413,044 D534E probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trbv3 T C 6: 41,048,401 I3T probably benign Het
Trbv4 T A 6: 41,059,629 Y29* probably null Het
Ttl A G 2: 129,075,984 N122S probably benign Het
Txndc11 T C 16: 11,075,071 T932A probably benign Het
Ube2e2 G A 14: 18,586,910 A150V probably damaging Het
Ube2ql1 T C 13: 69,739,340 M1V probably null Het
Uqcrc1 A G 9: 108,947,486 probably benign Het
Utrn T C 10: 12,486,483 D2702G probably damaging Het
Vcan T A 13: 89,692,691 D618V probably damaging Het
Vdac3-ps1 A G 13: 18,031,202 noncoding transcript Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zap70 G A 1: 36,770,949 V47M probably damaging Het
Zfp770 A G 2: 114,197,546 M14T possibly damaging Het
Zufsp C T 10: 33,949,462 G8D probably damaging Het
Other mutations in Rhbdl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Rhbdl3 APN 11 80353442 missense probably damaging 1.00
IGL02003:Rhbdl3 APN 11 80337516 missense possibly damaging 0.82
IGL02302:Rhbdl3 APN 11 80353681 makesense probably null
IGL02972:Rhbdl3 APN 11 80331916 splice site probably benign
IGL03028:Rhbdl3 APN 11 80323461 nonsense probably null
IGL03033:Rhbdl3 APN 11 80346827 missense probably damaging 0.99
IGL03113:Rhbdl3 APN 11 80353613 missense possibly damaging 0.69
R0193:Rhbdl3 UTSW 11 80353574 missense possibly damaging 0.55
R0358:Rhbdl3 UTSW 11 80353631 missense probably damaging 0.99
R0481:Rhbdl3 UTSW 11 80323349 splice site probably benign
R0616:Rhbdl3 UTSW 11 80331861 missense probably damaging 0.99
R1171:Rhbdl3 UTSW 11 80353592 missense possibly damaging 0.52
R2166:Rhbdl3 UTSW 11 80319697 missense probably damaging 1.00
R3500:Rhbdl3 UTSW 11 80319705 missense probably damaging 0.98
R4580:Rhbdl3 UTSW 11 80353645 missense probably damaging 1.00
R4900:Rhbdl3 UTSW 11 80319613 missense probably benign 0.13
R5276:Rhbdl3 UTSW 11 80319666 missense probably benign 0.07
R5513:Rhbdl3 UTSW 11 80331842 missense probably damaging 0.99
R5595:Rhbdl3 UTSW 11 80337583 missense probably damaging 0.99
R6372:Rhbdl3 UTSW 11 80330656 missense probably damaging 1.00
R6935:Rhbdl3 UTSW 11 80337496 missense probably damaging 1.00
R7252:Rhbdl3 UTSW 11 80337585 missense possibly damaging 0.60
R7389:Rhbdl3 UTSW 11 80346839 missense possibly damaging 0.95
R7404:Rhbdl3 UTSW 11 80346833 missense probably damaging 1.00
R7745:Rhbdl3 UTSW 11 80323579 missense possibly damaging 0.74
R7768:Rhbdl3 UTSW 11 80330621 missense probably benign
R8669:Rhbdl3 UTSW 11 80353513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCATGAGCTGCTCAAAG -3'
(R):5'- CCAGAACATACCTCCCTGTCTG -3'

Sequencing Primer
(F):5'- CAAAGAATGGGGCCTCGCAC -3'
(R):5'- GGGTAGCTGTGGGAAATATGCC -3'
Posted On2017-02-28