Mutagenetix > Incidental Mutation

Incidental Mutation 'R5941:Ints2'

460288

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

044133-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5941 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 86250972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 216 (N216K)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000139285]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: N216K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: N216K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: N216K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: N216K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132024

SMART Domains

Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	140	1e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

probably benign
Transcript: ENSMUST00000139285

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.2%

Validation Efficiency

97% (95/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,591,098	D70E	probably damaging	Het
Adamts14	C	T	10: 61,221,895	G561R	probably damaging	Het
Alpk3	A	T	7: 81,078,653	K510N	probably damaging	Het
Ap3b1	A	G	13: 94,440,273	N269D	probably benign	Het
Ap3b1	T	C	13: 94,483,265	S144P	probably damaging	Het
Apba2	C	A	7: 64,745,716	Q635K	probably benign	Het
Aspg	C	T	12: 112,113,085	T99I	probably benign	Het
Atp7b	A	G	8: 21,997,496	V1179A	probably damaging	Het
Bbs12	T	C	3: 37,320,048	V215A	probably damaging	Het
Bcl2l11	C	A	2: 128,127,783		probably benign	Het
Bglap3	T	G	3: 88,376,346		probably benign	Het
Cchcr1	G	A	17: 35,524,993	R284Q	probably damaging	Het
Cdh26	C	T	2: 178,481,650	Q662*	probably null	Het
Cftr	T	A	6: 18,313,646	F1290I	probably damaging	Het
Clip3	G	A	7: 30,292,306	E36K	probably damaging	Het
Cog2	A	G	8: 124,546,086	I541V	probably benign	Het
Cpt1b	A	T	15: 89,425,214	W39R	probably damaging	Het
Csmd1	A	G	8: 15,932,471	V2732A	probably damaging	Het
Dlec1	A	G	9: 119,126,312	D688G	probably damaging	Het
Dnah12	A	G	14: 26,706,867	E216G	probably benign	Het
Dnah7b	C	A	1: 46,187,290	L1294I	probably damaging	Het
Duox1	T	A	2: 122,344,156	L1265Q	probably damaging	Het
Fam91a1	T	A	15: 58,431,317	D358E	probably benign	Het
Fat3	A	C	9: 15,999,501	I1735S	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabrr1	T	A	4: 33,162,676	M414K	probably benign	Het
Gm21915	A	C	9: 40,670,699	E29D	possibly damaging	Het
Gm340	G	A	19: 41,586,400	R1198Q	probably damaging	Het
Gm9955	G	A	18: 24,709,263		probably benign	Het
Gpat2	C	A	2: 127,428,275	D69E	possibly damaging	Het
Grin2b	T	G	6: 135,736,373	I837L	probably damaging	Het
Gucy2g	T	C	19: 55,215,131	D745G	probably damaging	Het
H2-Q1	A	G	17: 35,321,356	Y139C	probably damaging	Het
Jmy	G	A	13: 93,498,825	P161L	probably benign	Het
Kctd11	G	A	11: 69,879,973	R80W	possibly damaging	Het
Kif7	A	G	7: 79,711,132		probably benign	Het
Kifc1	C	T	17: 33,883,085		probably benign	Het
Mir412	C	A	12: 109,743,299		noncoding transcript	Het
Mknk1	T	A	4: 115,876,637		probably benign	Het
Mmp16	A	G	4: 18,054,354		probably benign	Het
Mmp7	A	G	9: 7,697,645	H227R	probably damaging	Het
Myh4	A	C	11: 67,259,300	D1861A	probably damaging	Het
Nup205	T	C	6: 35,232,408	L1550P	probably damaging	Het
Olfr1218	T	A	2: 89,054,619	H269L	probably benign	Het
Olfr1510	C	T	14: 52,410,068	G268D	probably benign	Het
Olfr444	G	T	6: 42,955,716	A73S	possibly damaging	Het
Olfr48	T	A	2: 89,844,515	I153F	probably benign	Het
Olfr609	A	G	7: 103,492,720	S53P	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pafah1b2	A	T	9: 45,976,107	C35*	probably null	Het
Pappa	T	A	4: 65,314,593	F1323Y	possibly damaging	Het
Phtf2	A	T	5: 20,774,073	F519Y	probably damaging	Het
Pigk	T	C	3: 152,766,513	I354T	possibly damaging	Het
Plekha7	T	C	7: 116,124,805	D1265G	possibly damaging	Het
Prss12	A	G	3: 123,505,501	R641G	probably benign	Het
Prss28	A	G	17: 25,309,743	Y53C	probably damaging	Het
Rabgap1	G	T	2: 37,561,896	C936F	possibly damaging	Het
Rap1a	T	C	3: 105,732,069	I91M	possibly damaging	Het
Rap1gap2	A	T	11: 74,392,237	M679K	probably damaging	Het
Rapgef5	T	A	12: 117,728,738	L352I	probably damaging	Het
Rhbdl3	G	A	11: 80,331,889	V255M	probably benign	Het
Rhot1	T	C	11: 80,251,170		probably benign	Het
Rita1	A	C	5: 120,609,561	V224G	probably benign	Het
Ryr2	T	A	13: 11,687,902	Y2900F	probably damaging	Het
Scaf11	A	C	15: 96,420,308	H458Q	probably damaging	Het
Scamp4	T	A	10: 80,612,421	S159T	probably benign	Het
Setd5	T	A	6: 113,128,490	Y828N	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Sipa1l2	A	G	8: 125,473,536	S684P	probably damaging	Het
Stard9	A	T	2: 120,713,558	I4446F	probably damaging	Het
Sult1c2	T	C	17: 53,831,898	D217G	probably benign	Het
Supt16	C	A	14: 52,182,196	K148N	probably benign	Het
Syne3	G	A	12: 104,946,992	S570L	probably benign	Het
Tcf3	G	T	10: 80,413,044	D534E	probably benign	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Trbv3	T	C	6: 41,048,401	I3T	probably benign	Het
Trbv4	T	A	6: 41,059,629	Y29*	probably null	Het
Ttl	A	G	2: 129,075,984	N122S	probably benign	Het
Txndc11	T	C	16: 11,075,071	T932A	probably benign	Het
Ube2e2	G	A	14: 18,586,910	A150V	probably damaging	Het
Ube2ql1	T	C	13: 69,739,340	M1V	probably null	Het
Uqcrc1	A	G	9: 108,947,486		probably benign	Het
Utrn	T	C	10: 12,486,483	D2702G	probably damaging	Het
Vcan	T	A	13: 89,692,691	D618V	probably damaging	Het
Vdac3-ps1	A	G	13: 18,031,202		noncoding transcript	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zap70	G	A	1: 36,770,949	V47M	probably damaging	Het
Zfp770	A	G	2: 114,197,546	M14T	possibly damaging	Het
Zufsp	C	T	10: 33,949,462	G8D	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGCTTAGGCACTGGGTCCTAC -3'
(R):5'- TCTGGCTATGGAAAAGAGAACC -3'

Sequencing Primer
(F):5'- TACCCTTGCCCAGAAGGAG -3'
(R):5'- CCTGTAGGGGTCACGTCTCAATAG -3'

Posted On

2017-02-28