Incidental Mutation 'R5941:Ap3b1'
ID 460297
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 044133-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R5941 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94576781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 269 (N269D)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably benign
Transcript: ENSMUST00000022196
AA Change: N269D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N269D

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,190,321 (GRCm39) D70E probably damaging Het
Adamts14 C T 10: 61,057,674 (GRCm39) G561R probably damaging Het
Alpk3 A T 7: 80,728,401 (GRCm39) K510N probably damaging Het
Apba2 C A 7: 64,395,464 (GRCm39) Q635K probably benign Het
Aspg C T 12: 112,079,519 (GRCm39) T99I probably benign Het
Atp7b A G 8: 22,487,512 (GRCm39) V1179A probably damaging Het
Bbs12 T C 3: 37,374,197 (GRCm39) V215A probably damaging Het
Bcl2l11 C A 2: 127,969,703 (GRCm39) probably benign Het
Bglap3 T G 3: 88,283,653 (GRCm39) probably benign Het
Cchcr1 G A 17: 35,835,890 (GRCm39) R284Q probably damaging Het
Cdh26 C T 2: 178,123,443 (GRCm39) Q662* probably null Het
Cftr T A 6: 18,313,645 (GRCm39) F1290I probably damaging Het
Clip3 G A 7: 29,991,731 (GRCm39) E36K probably damaging Het
Cog2 A G 8: 125,272,825 (GRCm39) I541V probably benign Het
Cpt1b A T 15: 89,309,417 (GRCm39) W39R probably damaging Het
Csmd1 A G 8: 15,982,471 (GRCm39) V2732A probably damaging Het
Dlec1 A G 9: 118,955,380 (GRCm39) D688G probably damaging Het
Dnah12 A G 14: 26,428,022 (GRCm39) E216G probably benign Het
Dnah7b C A 1: 46,226,450 (GRCm39) L1294I probably damaging Het
Duox1 T A 2: 122,174,637 (GRCm39) L1265Q probably damaging Het
Fam91a1 T A 15: 58,303,166 (GRCm39) D358E probably benign Het
Fat3 A C 9: 15,910,797 (GRCm39) I1735S probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Gabrr1 T A 4: 33,162,676 (GRCm39) M414K probably benign Het
Gm21915 A C 9: 40,581,995 (GRCm39) E29D possibly damaging Het
Gm9955 G A 18: 24,842,320 (GRCm39) probably benign Het
Gpat2 C A 2: 127,270,195 (GRCm39) D69E possibly damaging Het
Grin2b T G 6: 135,713,371 (GRCm39) I837L probably damaging Het
Gucy2g T C 19: 55,203,563 (GRCm39) D745G probably damaging Het
H2-Q1 A G 17: 35,540,332 (GRCm39) Y139C probably damaging Het
Ints2 G C 11: 86,141,798 (GRCm39) N216K probably benign Het
Jmy G A 13: 93,635,333 (GRCm39) P161L probably benign Het
Kctd11 G A 11: 69,770,799 (GRCm39) R80W possibly damaging Het
Kif7 A G 7: 79,360,880 (GRCm39) probably benign Het
Kifc1 C T 17: 34,102,059 (GRCm39) probably benign Het
Lcor G A 19: 41,574,839 (GRCm39) R1198Q probably damaging Het
Mir412 C A 12: 109,709,733 (GRCm39) noncoding transcript Het
Mknk1 T A 4: 115,733,834 (GRCm39) probably benign Het
Mmp16 A G 4: 18,054,354 (GRCm39) probably benign Het
Mmp7 A G 9: 7,697,646 (GRCm39) H227R probably damaging Het
Myh4 A C 11: 67,150,126 (GRCm39) D1861A probably damaging Het
Nup205 T C 6: 35,209,343 (GRCm39) L1550P probably damaging Het
Or10g1 C T 14: 52,647,525 (GRCm39) G268D probably benign Het
Or2a56 G T 6: 42,932,650 (GRCm39) A73S possibly damaging Het
Or4c113 T A 2: 88,884,963 (GRCm39) H269L probably benign Het
Or4c58 T A 2: 89,674,859 (GRCm39) I153F probably benign Het
Or51af1 A G 7: 103,141,927 (GRCm39) S53P possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pafah1b2 A T 9: 45,887,405 (GRCm39) C35* probably null Het
Pappa T A 4: 65,232,830 (GRCm39) F1323Y possibly damaging Het
Phtf2 A T 5: 20,979,071 (GRCm39) F519Y probably damaging Het
Pigk T C 3: 152,472,150 (GRCm39) I354T possibly damaging Het
Plekha7 T C 7: 115,724,040 (GRCm39) D1265G possibly damaging Het
Prss12 A G 3: 123,299,150 (GRCm39) R641G probably benign Het
Prss28 A G 17: 25,528,717 (GRCm39) Y53C probably damaging Het
Rabgap1 G T 2: 37,451,908 (GRCm39) C936F possibly damaging Het
Rap1a T C 3: 105,639,385 (GRCm39) I91M possibly damaging Het
Rap1gap2 A T 11: 74,283,063 (GRCm39) M679K probably damaging Het
Rapgef5 T A 12: 117,692,473 (GRCm39) L352I probably damaging Het
Rhbdl3 G A 11: 80,222,715 (GRCm39) V255M probably benign Het
Rhot1 T C 11: 80,141,996 (GRCm39) probably benign Het
Rita1 A C 5: 120,747,626 (GRCm39) V224G probably benign Het
Ryr2 T A 13: 11,702,788 (GRCm39) Y2900F probably damaging Het
Scaf11 A C 15: 96,318,189 (GRCm39) H458Q probably damaging Het
Scamp4 T A 10: 80,448,255 (GRCm39) S159T probably benign Het
Setd5 T A 6: 113,105,451 (GRCm39) Y828N probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Sipa1l2 A G 8: 126,200,275 (GRCm39) S684P probably damaging Het
Stard9 A T 2: 120,544,039 (GRCm39) I4446F probably damaging Het
Sult1c2 T C 17: 54,138,926 (GRCm39) D217G probably benign Het
Supt16 C A 14: 52,419,653 (GRCm39) K148N probably benign Het
Syne3 G A 12: 104,913,251 (GRCm39) S570L probably benign Het
Tcf3 G T 10: 80,248,878 (GRCm39) D534E probably benign Het
Tmed6 G T 8: 107,790,786 (GRCm39) T87K probably damaging Het
Trbv3 T C 6: 41,025,335 (GRCm39) I3T probably benign Het
Trbv4 T A 6: 41,036,563 (GRCm39) Y29* probably null Het
Ttl A G 2: 128,917,904 (GRCm39) N122S probably benign Het
Txndc11 T C 16: 10,892,935 (GRCm39) T932A probably benign Het
Ube2e2 G A 14: 18,586,910 (GRCm38) A150V probably damaging Het
Ube2ql1 T C 13: 69,887,459 (GRCm39) M1V probably null Het
Uqcrc1 A G 9: 108,776,554 (GRCm39) probably benign Het
Utrn T C 10: 12,362,227 (GRCm39) D2702G probably damaging Het
Vcan T A 13: 89,840,810 (GRCm39) D618V probably damaging Het
Vdac3-ps1 A G 13: 18,205,787 (GRCm39) noncoding transcript Het
Wee1 TCCCC TCCC 7: 109,723,776 (GRCm39) probably null Het
Zap70 G A 1: 36,810,030 (GRCm39) V47M probably damaging Het
Zfp770 A G 2: 114,028,027 (GRCm39) M14T possibly damaging Het
Zup1 C T 10: 33,825,458 (GRCm39) G8D probably damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGTGTCATCCCTTAGGG -3'
(R):5'- AACAGTTCCTTCAGGCCTCC -3'

Sequencing Primer
(F):5'- ATACCCTGTGTCCTACGTGGG -3'
(R):5'- TTCAGGCCTCCACGTACCG -3'
Posted On 2017-02-28