Mutagenetix > Incidental Mutation

Incidental Mutation 'R5941:Ap3b1'

460297

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

044133-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.408) question?

Stock #

R5941 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94440273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 269 (N269D)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably benign
Transcript: ENSMUST00000022196
AA Change: N269D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N269D

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Meta Mutation Damage Score

0.0605

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.2%

Validation Efficiency

97% (95/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,591,098	D70E	probably damaging	Het
Adamts14	C	T	10: 61,221,895	G561R	probably damaging	Het
Alpk3	A	T	7: 81,078,653	K510N	probably damaging	Het
Apba2	C	A	7: 64,745,716	Q635K	probably benign	Het
Aspg	C	T	12: 112,113,085	T99I	probably benign	Het
Atp7b	A	G	8: 21,997,496	V1179A	probably damaging	Het
Bbs12	T	C	3: 37,320,048	V215A	probably damaging	Het
Bcl2l11	C	A	2: 128,127,783		probably benign	Het
Bglap3	T	G	3: 88,376,346		probably benign	Het
Cchcr1	G	A	17: 35,524,993	R284Q	probably damaging	Het
Cdh26	C	T	2: 178,481,650	Q662*	probably null	Het
Cftr	T	A	6: 18,313,646	F1290I	probably damaging	Het
Clip3	G	A	7: 30,292,306	E36K	probably damaging	Het
Cog2	A	G	8: 124,546,086	I541V	probably benign	Het
Cpt1b	A	T	15: 89,425,214	W39R	probably damaging	Het
Csmd1	A	G	8: 15,932,471	V2732A	probably damaging	Het
Dlec1	A	G	9: 119,126,312	D688G	probably damaging	Het
Dnah12	A	G	14: 26,706,867	E216G	probably benign	Het
Dnah7b	C	A	1: 46,187,290	L1294I	probably damaging	Het
Duox1	T	A	2: 122,344,156	L1265Q	probably damaging	Het
Fam91a1	T	A	15: 58,431,317	D358E	probably benign	Het
Fat3	A	C	9: 15,999,501	I1735S	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabrr1	T	A	4: 33,162,676	M414K	probably benign	Het
Gm21915	A	C	9: 40,670,699	E29D	possibly damaging	Het
Gm340	G	A	19: 41,586,400	R1198Q	probably damaging	Het
Gm9955	G	A	18: 24,709,263		probably benign	Het
Gpat2	C	A	2: 127,428,275	D69E	possibly damaging	Het
Grin2b	T	G	6: 135,736,373	I837L	probably damaging	Het
Gucy2g	T	C	19: 55,215,131	D745G	probably damaging	Het
H2-Q1	A	G	17: 35,321,356	Y139C	probably damaging	Het
Ints2	G	C	11: 86,250,972	N216K	probably benign	Het
Jmy	G	A	13: 93,498,825	P161L	probably benign	Het
Kctd11	G	A	11: 69,879,973	R80W	possibly damaging	Het
Kif7	A	G	7: 79,711,132		probably benign	Het
Kifc1	C	T	17: 33,883,085		probably benign	Het
Mir412	C	A	12: 109,743,299		noncoding transcript	Het
Mknk1	T	A	4: 115,876,637		probably benign	Het
Mmp16	A	G	4: 18,054,354		probably benign	Het
Mmp7	A	G	9: 7,697,645	H227R	probably damaging	Het
Myh4	A	C	11: 67,259,300	D1861A	probably damaging	Het
Nup205	T	C	6: 35,232,408	L1550P	probably damaging	Het
Olfr1218	T	A	2: 89,054,619	H269L	probably benign	Het
Olfr1510	C	T	14: 52,410,068	G268D	probably benign	Het
Olfr444	G	T	6: 42,955,716	A73S	possibly damaging	Het
Olfr48	T	A	2: 89,844,515	I153F	probably benign	Het
Olfr609	A	G	7: 103,492,720	S53P	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pafah1b2	A	T	9: 45,976,107	C35*	probably null	Het
Pappa	T	A	4: 65,314,593	F1323Y	possibly damaging	Het
Phtf2	A	T	5: 20,774,073	F519Y	probably damaging	Het
Pigk	T	C	3: 152,766,513	I354T	possibly damaging	Het
Plekha7	T	C	7: 116,124,805	D1265G	possibly damaging	Het
Prss12	A	G	3: 123,505,501	R641G	probably benign	Het
Prss28	A	G	17: 25,309,743	Y53C	probably damaging	Het
Rabgap1	G	T	2: 37,561,896	C936F	possibly damaging	Het
Rap1a	T	C	3: 105,732,069	I91M	possibly damaging	Het
Rap1gap2	A	T	11: 74,392,237	M679K	probably damaging	Het
Rapgef5	T	A	12: 117,728,738	L352I	probably damaging	Het
Rhbdl3	G	A	11: 80,331,889	V255M	probably benign	Het
Rhot1	T	C	11: 80,251,170		probably benign	Het
Rita1	A	C	5: 120,609,561	V224G	probably benign	Het
Ryr2	T	A	13: 11,687,902	Y2900F	probably damaging	Het
Scaf11	A	C	15: 96,420,308	H458Q	probably damaging	Het
Scamp4	T	A	10: 80,612,421	S159T	probably benign	Het
Setd5	T	A	6: 113,128,490	Y828N	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Sipa1l2	A	G	8: 125,473,536	S684P	probably damaging	Het
Stard9	A	T	2: 120,713,558	I4446F	probably damaging	Het
Sult1c2	T	C	17: 53,831,898	D217G	probably benign	Het
Supt16	C	A	14: 52,182,196	K148N	probably benign	Het
Syne3	G	A	12: 104,946,992	S570L	probably benign	Het
Tcf3	G	T	10: 80,413,044	D534E	probably benign	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Trbv3	T	C	6: 41,048,401	I3T	probably benign	Het
Trbv4	T	A	6: 41,059,629	Y29*	probably null	Het
Ttl	A	G	2: 129,075,984	N122S	probably benign	Het
Txndc11	T	C	16: 11,075,071	T932A	probably benign	Het
Ube2e2	G	A	14: 18,586,910	A150V	probably damaging	Het
Ube2ql1	T	C	13: 69,739,340	M1V	probably null	Het
Uqcrc1	A	G	9: 108,947,486		probably benign	Het
Utrn	T	C	10: 12,486,483	D2702G	probably damaging	Het
Vcan	T	A	13: 89,692,691	D618V	probably damaging	Het
Vdac3-ps1	A	G	13: 18,031,202		noncoding transcript	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zap70	G	A	1: 36,770,949	V47M	probably damaging	Het
Zfp770	A	G	2: 114,197,546	M14T	possibly damaging	Het
Zufsp	C	T	10: 33,949,462	G8D	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451087	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCAGTGTCATCCCTTAGGG -3'
(R):5'- AACAGTTCCTTCAGGCCTCC -3'

Sequencing Primer
(F):5'- ATACCCTGTGTCCTACGTGGG -3'
(R):5'- TTCAGGCCTCCACGTACCG -3'

Posted On

2017-02-28