Incidental Mutation 'R5941:Supt16'
ID 460302
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission 044133-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R5941 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 52182196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 148 (K148N)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046709
AA Change: K148N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: K148N

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,591,098 D70E probably damaging Het
Adamts14 C T 10: 61,221,895 G561R probably damaging Het
Alpk3 A T 7: 81,078,653 K510N probably damaging Het
Ap3b1 A G 13: 94,440,273 N269D probably benign Het
Ap3b1 T C 13: 94,483,265 S144P probably damaging Het
Apba2 C A 7: 64,745,716 Q635K probably benign Het
Aspg C T 12: 112,113,085 T99I probably benign Het
Atp7b A G 8: 21,997,496 V1179A probably damaging Het
Bbs12 T C 3: 37,320,048 V215A probably damaging Het
Bcl2l11 C A 2: 128,127,783 probably benign Het
Bglap3 T G 3: 88,376,346 probably benign Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cdh26 C T 2: 178,481,650 Q662* probably null Het
Cftr T A 6: 18,313,646 F1290I probably damaging Het
Clip3 G A 7: 30,292,306 E36K probably damaging Het
Cog2 A G 8: 124,546,086 I541V probably benign Het
Cpt1b A T 15: 89,425,214 W39R probably damaging Het
Csmd1 A G 8: 15,932,471 V2732A probably damaging Het
Dlec1 A G 9: 119,126,312 D688G probably damaging Het
Dnah12 A G 14: 26,706,867 E216G probably benign Het
Dnah7b C A 1: 46,187,290 L1294I probably damaging Het
Duox1 T A 2: 122,344,156 L1265Q probably damaging Het
Fam91a1 T A 15: 58,431,317 D358E probably benign Het
Fat3 A C 9: 15,999,501 I1735S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabrr1 T A 4: 33,162,676 M414K probably benign Het
Gm21915 A C 9: 40,670,699 E29D possibly damaging Het
Gm340 G A 19: 41,586,400 R1198Q probably damaging Het
Gm9955 G A 18: 24,709,263 probably benign Het
Gpat2 C A 2: 127,428,275 D69E possibly damaging Het
Grin2b T G 6: 135,736,373 I837L probably damaging Het
Gucy2g T C 19: 55,215,131 D745G probably damaging Het
H2-Q1 A G 17: 35,321,356 Y139C probably damaging Het
Ints2 G C 11: 86,250,972 N216K probably benign Het
Jmy G A 13: 93,498,825 P161L probably benign Het
Kctd11 G A 11: 69,879,973 R80W possibly damaging Het
Kif7 A G 7: 79,711,132 probably benign Het
Kifc1 C T 17: 33,883,085 probably benign Het
Mir412 C A 12: 109,743,299 noncoding transcript Het
Mknk1 T A 4: 115,876,637 probably benign Het
Mmp16 A G 4: 18,054,354 probably benign Het
Mmp7 A G 9: 7,697,645 H227R probably damaging Het
Myh4 A C 11: 67,259,300 D1861A probably damaging Het
Nup205 T C 6: 35,232,408 L1550P probably damaging Het
Olfr1218 T A 2: 89,054,619 H269L probably benign Het
Olfr1510 C T 14: 52,410,068 G268D probably benign Het
Olfr444 G T 6: 42,955,716 A73S possibly damaging Het
Olfr48 T A 2: 89,844,515 I153F probably benign Het
Olfr609 A G 7: 103,492,720 S53P possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pafah1b2 A T 9: 45,976,107 C35* probably null Het
Pappa T A 4: 65,314,593 F1323Y possibly damaging Het
Phtf2 A T 5: 20,774,073 F519Y probably damaging Het
Pigk T C 3: 152,766,513 I354T possibly damaging Het
Plekha7 T C 7: 116,124,805 D1265G possibly damaging Het
Prss12 A G 3: 123,505,501 R641G probably benign Het
Prss28 A G 17: 25,309,743 Y53C probably damaging Het
Rabgap1 G T 2: 37,561,896 C936F possibly damaging Het
Rap1a T C 3: 105,732,069 I91M possibly damaging Het
Rap1gap2 A T 11: 74,392,237 M679K probably damaging Het
Rapgef5 T A 12: 117,728,738 L352I probably damaging Het
Rhbdl3 G A 11: 80,331,889 V255M probably benign Het
Rhot1 T C 11: 80,251,170 probably benign Het
Rita1 A C 5: 120,609,561 V224G probably benign Het
Ryr2 T A 13: 11,687,902 Y2900F probably damaging Het
Scaf11 A C 15: 96,420,308 H458Q probably damaging Het
Scamp4 T A 10: 80,612,421 S159T probably benign Het
Setd5 T A 6: 113,128,490 Y828N probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sipa1l2 A G 8: 125,473,536 S684P probably damaging Het
Stard9 A T 2: 120,713,558 I4446F probably damaging Het
Sult1c2 T C 17: 53,831,898 D217G probably benign Het
Syne3 G A 12: 104,946,992 S570L probably benign Het
Tcf3 G T 10: 80,413,044 D534E probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trbv3 T C 6: 41,048,401 I3T probably benign Het
Trbv4 T A 6: 41,059,629 Y29* probably null Het
Ttl A G 2: 129,075,984 N122S probably benign Het
Txndc11 T C 16: 11,075,071 T932A probably benign Het
Ube2e2 G A 14: 18,586,910 A150V probably damaging Het
Ube2ql1 T C 13: 69,739,340 M1V probably null Het
Uqcrc1 A G 9: 108,947,486 probably benign Het
Utrn T C 10: 12,486,483 D2702G probably damaging Het
Vcan T A 13: 89,692,691 D618V probably damaging Het
Vdac3-ps1 A G 13: 18,031,202 noncoding transcript Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zap70 G A 1: 36,770,949 V47M probably damaging Het
Zfp770 A G 2: 114,197,546 M14T possibly damaging Het
Zufsp C T 10: 33,949,462 G8D probably damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
R9743:Supt16 UTSW 14 52171482 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- TGACGCACTTATTTTCTGACTG -3'
(R):5'- GCTCAGAGAACTCATCCTCCATG -3'

Sequencing Primer
(F):5'- ACGAACATGGATTTCCCC -3'
(R):5'- CAGAGAACTCATCCTCCATGGTTTAG -3'
Posted On 2017-02-28