Incidental Mutation 'R5941:Scaf11'
ID 460306
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene Name SR-related CTD-associated factor 11
Synonyms 2610510E10Rik, Srsf2ip, SIP1, Sfrs2ip, SRRP129, CASP11, 1110061H03Rik
MMRRC Submission 044133-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5941 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 96309580-96358695 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 96318189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 458 (H458Q)
Ref Sequence ENSEMBL: ENSMUSP00000154321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
AlphaFold E9PZM7
Predicted Effect possibly damaging
Transcript: ENSMUST00000047835
AA Change: H458Q

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: H458Q

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227069
AA Change: H458Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228072
Predicted Effect probably benign
Transcript: ENSMUST00000228260
Predicted Effect probably benign
Transcript: ENSMUST00000228535
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,190,321 (GRCm39) D70E probably damaging Het
Adamts14 C T 10: 61,057,674 (GRCm39) G561R probably damaging Het
Alpk3 A T 7: 80,728,401 (GRCm39) K510N probably damaging Het
Ap3b1 A G 13: 94,576,781 (GRCm39) N269D probably benign Het
Ap3b1 T C 13: 94,619,773 (GRCm39) S144P probably damaging Het
Apba2 C A 7: 64,395,464 (GRCm39) Q635K probably benign Het
Aspg C T 12: 112,079,519 (GRCm39) T99I probably benign Het
Atp7b A G 8: 22,487,512 (GRCm39) V1179A probably damaging Het
Bbs12 T C 3: 37,374,197 (GRCm39) V215A probably damaging Het
Bcl2l11 C A 2: 127,969,703 (GRCm39) probably benign Het
Bglap3 T G 3: 88,283,653 (GRCm39) probably benign Het
Cchcr1 G A 17: 35,835,890 (GRCm39) R284Q probably damaging Het
Cdh26 C T 2: 178,123,443 (GRCm39) Q662* probably null Het
Cftr T A 6: 18,313,645 (GRCm39) F1290I probably damaging Het
Clip3 G A 7: 29,991,731 (GRCm39) E36K probably damaging Het
Cog2 A G 8: 125,272,825 (GRCm39) I541V probably benign Het
Cpt1b A T 15: 89,309,417 (GRCm39) W39R probably damaging Het
Csmd1 A G 8: 15,982,471 (GRCm39) V2732A probably damaging Het
Dlec1 A G 9: 118,955,380 (GRCm39) D688G probably damaging Het
Dnah12 A G 14: 26,428,022 (GRCm39) E216G probably benign Het
Dnah7b C A 1: 46,226,450 (GRCm39) L1294I probably damaging Het
Duox1 T A 2: 122,174,637 (GRCm39) L1265Q probably damaging Het
Fam91a1 T A 15: 58,303,166 (GRCm39) D358E probably benign Het
Fat3 A C 9: 15,910,797 (GRCm39) I1735S probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Gabrr1 T A 4: 33,162,676 (GRCm39) M414K probably benign Het
Gm21915 A C 9: 40,581,995 (GRCm39) E29D possibly damaging Het
Gm9955 G A 18: 24,842,320 (GRCm39) probably benign Het
Gpat2 C A 2: 127,270,195 (GRCm39) D69E possibly damaging Het
Grin2b T G 6: 135,713,371 (GRCm39) I837L probably damaging Het
Gucy2g T C 19: 55,203,563 (GRCm39) D745G probably damaging Het
H2-Q1 A G 17: 35,540,332 (GRCm39) Y139C probably damaging Het
Ints2 G C 11: 86,141,798 (GRCm39) N216K probably benign Het
Jmy G A 13: 93,635,333 (GRCm39) P161L probably benign Het
Kctd11 G A 11: 69,770,799 (GRCm39) R80W possibly damaging Het
Kif7 A G 7: 79,360,880 (GRCm39) probably benign Het
Kifc1 C T 17: 34,102,059 (GRCm39) probably benign Het
Lcor G A 19: 41,574,839 (GRCm39) R1198Q probably damaging Het
Mir412 C A 12: 109,709,733 (GRCm39) noncoding transcript Het
Mknk1 T A 4: 115,733,834 (GRCm39) probably benign Het
Mmp16 A G 4: 18,054,354 (GRCm39) probably benign Het
Mmp7 A G 9: 7,697,646 (GRCm39) H227R probably damaging Het
Myh4 A C 11: 67,150,126 (GRCm39) D1861A probably damaging Het
Nup205 T C 6: 35,209,343 (GRCm39) L1550P probably damaging Het
Or10g1 C T 14: 52,647,525 (GRCm39) G268D probably benign Het
Or2a56 G T 6: 42,932,650 (GRCm39) A73S possibly damaging Het
Or4c113 T A 2: 88,884,963 (GRCm39) H269L probably benign Het
Or4c58 T A 2: 89,674,859 (GRCm39) I153F probably benign Het
Or51af1 A G 7: 103,141,927 (GRCm39) S53P possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pafah1b2 A T 9: 45,887,405 (GRCm39) C35* probably null Het
Pappa T A 4: 65,232,830 (GRCm39) F1323Y possibly damaging Het
Phtf2 A T 5: 20,979,071 (GRCm39) F519Y probably damaging Het
Pigk T C 3: 152,472,150 (GRCm39) I354T possibly damaging Het
Plekha7 T C 7: 115,724,040 (GRCm39) D1265G possibly damaging Het
Prss12 A G 3: 123,299,150 (GRCm39) R641G probably benign Het
Prss28 A G 17: 25,528,717 (GRCm39) Y53C probably damaging Het
Rabgap1 G T 2: 37,451,908 (GRCm39) C936F possibly damaging Het
Rap1a T C 3: 105,639,385 (GRCm39) I91M possibly damaging Het
Rap1gap2 A T 11: 74,283,063 (GRCm39) M679K probably damaging Het
Rapgef5 T A 12: 117,692,473 (GRCm39) L352I probably damaging Het
Rhbdl3 G A 11: 80,222,715 (GRCm39) V255M probably benign Het
Rhot1 T C 11: 80,141,996 (GRCm39) probably benign Het
Rita1 A C 5: 120,747,626 (GRCm39) V224G probably benign Het
Ryr2 T A 13: 11,702,788 (GRCm39) Y2900F probably damaging Het
Scamp4 T A 10: 80,448,255 (GRCm39) S159T probably benign Het
Setd5 T A 6: 113,105,451 (GRCm39) Y828N probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Sipa1l2 A G 8: 126,200,275 (GRCm39) S684P probably damaging Het
Stard9 A T 2: 120,544,039 (GRCm39) I4446F probably damaging Het
Sult1c2 T C 17: 54,138,926 (GRCm39) D217G probably benign Het
Supt16 C A 14: 52,419,653 (GRCm39) K148N probably benign Het
Syne3 G A 12: 104,913,251 (GRCm39) S570L probably benign Het
Tcf3 G T 10: 80,248,878 (GRCm39) D534E probably benign Het
Tmed6 G T 8: 107,790,786 (GRCm39) T87K probably damaging Het
Trbv3 T C 6: 41,025,335 (GRCm39) I3T probably benign Het
Trbv4 T A 6: 41,036,563 (GRCm39) Y29* probably null Het
Ttl A G 2: 128,917,904 (GRCm39) N122S probably benign Het
Txndc11 T C 16: 10,892,935 (GRCm39) T932A probably benign Het
Ube2e2 G A 14: 18,586,910 (GRCm38) A150V probably damaging Het
Ube2ql1 T C 13: 69,887,459 (GRCm39) M1V probably null Het
Uqcrc1 A G 9: 108,776,554 (GRCm39) probably benign Het
Utrn T C 10: 12,362,227 (GRCm39) D2702G probably damaging Het
Vcan T A 13: 89,840,810 (GRCm39) D618V probably damaging Het
Vdac3-ps1 A G 13: 18,205,787 (GRCm39) noncoding transcript Het
Wee1 TCCCC TCCC 7: 109,723,776 (GRCm39) probably null Het
Zap70 G A 1: 36,810,030 (GRCm39) V47M probably damaging Het
Zfp770 A G 2: 114,028,027 (GRCm39) M14T possibly damaging Het
Zup1 C T 10: 33,825,458 (GRCm39) G8D probably damaging Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96,316,461 (GRCm39) missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96,318,361 (GRCm39) missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96,317,007 (GRCm39) missense probably benign 0.04
IGL01547:Scaf11 APN 15 96,316,310 (GRCm39) missense probably benign 0.14
IGL01697:Scaf11 APN 15 96,321,504 (GRCm39) splice site probably benign
IGL01780:Scaf11 APN 15 96,318,725 (GRCm39) missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96,316,637 (GRCm39) missense probably benign 0.01
IGL02740:Scaf11 APN 15 96,316,883 (GRCm39) missense probably benign 0.01
IGL02805:Scaf11 APN 15 96,318,063 (GRCm39) missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96,318,064 (GRCm39) splice site probably null
R0173:Scaf11 UTSW 15 96,318,075 (GRCm39) missense probably benign 0.00
R0379:Scaf11 UTSW 15 96,329,697 (GRCm39) missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96,318,368 (GRCm39) missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96,316,339 (GRCm39) missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96,316,522 (GRCm39) nonsense probably null
R0727:Scaf11 UTSW 15 96,317,324 (GRCm39) missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96,316,570 (GRCm39) missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96,321,434 (GRCm39) missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96,329,706 (GRCm39) missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96,316,176 (GRCm39) missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96,316,721 (GRCm39) nonsense probably null
R2092:Scaf11 UTSW 15 96,313,708 (GRCm39) missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96,317,196 (GRCm39) missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96,318,404 (GRCm39) missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96,312,745 (GRCm39) missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96,316,417 (GRCm39) missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96,344,396 (GRCm39) missense probably benign 0.00
R4424:Scaf11 UTSW 15 96,316,309 (GRCm39) missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96,322,719 (GRCm39) missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96,317,981 (GRCm39) splice site probably null
R4647:Scaf11 UTSW 15 96,317,981 (GRCm39) splice site probably null
R4724:Scaf11 UTSW 15 96,312,729 (GRCm39) missense probably benign 0.40
R4748:Scaf11 UTSW 15 96,318,302 (GRCm39) nonsense probably null
R4926:Scaf11 UTSW 15 96,316,123 (GRCm39) missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96,313,798 (GRCm39) missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96,318,313 (GRCm39) missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96,317,423 (GRCm39) missense probably benign 0.26
R5277:Scaf11 UTSW 15 96,317,107 (GRCm39) missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96,315,001 (GRCm39) missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96,317,339 (GRCm39) missense probably benign 0.28
R5481:Scaf11 UTSW 15 96,318,498 (GRCm39) missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96,314,962 (GRCm39) missense probably benign 0.14
R6123:Scaf11 UTSW 15 96,318,335 (GRCm39) missense probably benign 0.29
R6166:Scaf11 UTSW 15 96,322,543 (GRCm39) missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96,317,341 (GRCm39) splice site probably null
R6863:Scaf11 UTSW 15 96,317,300 (GRCm39) missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96,318,209 (GRCm39) missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96,317,042 (GRCm39) missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96,318,268 (GRCm39) missense possibly damaging 0.92
R7790:Scaf11 UTSW 15 96,316,942 (GRCm39) missense possibly damaging 0.60
R8056:Scaf11 UTSW 15 96,312,698 (GRCm39) nonsense probably null
R8104:Scaf11 UTSW 15 96,316,483 (GRCm39) missense probably benign 0.34
R8129:Scaf11 UTSW 15 96,317,350 (GRCm39) missense probably damaging 1.00
R8134:Scaf11 UTSW 15 96,318,592 (GRCm39) missense probably damaging 1.00
R8523:Scaf11 UTSW 15 96,316,988 (GRCm39) missense probably damaging 1.00
R8743:Scaf11 UTSW 15 96,313,669 (GRCm39) missense probably benign 0.16
R8955:Scaf11 UTSW 15 96,318,371 (GRCm39) missense probably damaging 0.98
R8987:Scaf11 UTSW 15 96,316,557 (GRCm39) nonsense probably null
R9118:Scaf11 UTSW 15 96,319,886 (GRCm39) missense probably benign
R9127:Scaf11 UTSW 15 96,312,764 (GRCm39) missense probably benign 0.01
R9534:Scaf11 UTSW 15 96,318,209 (GRCm39) missense possibly damaging 0.84
R9628:Scaf11 UTSW 15 96,317,398 (GRCm39) missense probably benign 0.15
R9630:Scaf11 UTSW 15 96,316,049 (GRCm39) missense probably damaging 1.00
R9688:Scaf11 UTSW 15 96,313,808 (GRCm39) missense probably damaging 1.00
R9689:Scaf11 UTSW 15 96,316,195 (GRCm39) missense probably damaging 1.00
R9746:Scaf11 UTSW 15 96,318,298 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCTGCTCTTGGTGTTC -3'
(R):5'- TTCCCCTCCAGCTGAATCAG -3'

Sequencing Primer
(F):5'- TGGTGTTCTGCTGAATCCC -3'
(R):5'- ATCATCTAGCGATTCAGTAGAGG -3'
Posted On 2017-02-28