Incidental Mutation 'R5941:Scaf11'
ID460306
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene NameSR-related CTD-associated factor 11
SynonymsSrsf2ip, Sfrs2ip, SIP1, CASP11, 1110061H03Rik, SRRP129, 2610510E10Rik
MMRRC Submission 044133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5941 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96411699-96460843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 96420308 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 458 (H458Q)
Ref Sequence ENSEMBL: ENSMUSP00000154321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047835
AA Change: H458Q

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: H458Q

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227069
AA Change: H458Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228072
Predicted Effect probably benign
Transcript: ENSMUST00000228260
Predicted Effect probably benign
Transcript: ENSMUST00000228535
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,591,098 D70E probably damaging Het
Adamts14 C T 10: 61,221,895 G561R probably damaging Het
Alpk3 A T 7: 81,078,653 K510N probably damaging Het
Ap3b1 A G 13: 94,440,273 N269D probably benign Het
Ap3b1 T C 13: 94,483,265 S144P probably damaging Het
Apba2 C A 7: 64,745,716 Q635K probably benign Het
Aspg C T 12: 112,113,085 T99I probably benign Het
Atp7b A G 8: 21,997,496 V1179A probably damaging Het
Bbs12 T C 3: 37,320,048 V215A probably damaging Het
Bcl2l11 C A 2: 128,127,783 probably benign Het
Bglap3 T G 3: 88,376,346 probably benign Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cdh26 C T 2: 178,481,650 Q662* probably null Het
Cftr T A 6: 18,313,646 F1290I probably damaging Het
Clip3 G A 7: 30,292,306 E36K probably damaging Het
Cog2 A G 8: 124,546,086 I541V probably benign Het
Cpt1b A T 15: 89,425,214 W39R probably damaging Het
Csmd1 A G 8: 15,932,471 V2732A probably damaging Het
Dlec1 A G 9: 119,126,312 D688G probably damaging Het
Dnah12 A G 14: 26,706,867 E216G probably benign Het
Dnah7b C A 1: 46,187,290 L1294I probably damaging Het
Duox1 T A 2: 122,344,156 L1265Q probably damaging Het
Fam91a1 T A 15: 58,431,317 D358E probably benign Het
Fat3 A C 9: 15,999,501 I1735S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabrr1 T A 4: 33,162,676 M414K probably benign Het
Gm21915 A C 9: 40,670,699 E29D possibly damaging Het
Gm340 G A 19: 41,586,400 R1198Q probably damaging Het
Gm9955 G A 18: 24,709,263 probably benign Het
Gpat2 C A 2: 127,428,275 D69E possibly damaging Het
Grin2b T G 6: 135,736,373 I837L probably damaging Het
Gucy2g T C 19: 55,215,131 D745G probably damaging Het
H2-Q1 A G 17: 35,321,356 Y139C probably damaging Het
Ints2 G C 11: 86,250,972 N216K probably benign Het
Jmy G A 13: 93,498,825 P161L probably benign Het
Kctd11 G A 11: 69,879,973 R80W possibly damaging Het
Kif7 A G 7: 79,711,132 probably benign Het
Kifc1 C T 17: 33,883,085 probably benign Het
Mir412 C A 12: 109,743,299 noncoding transcript Het
Mknk1 T A 4: 115,876,637 probably benign Het
Mmp16 A G 4: 18,054,354 probably benign Het
Mmp7 A G 9: 7,697,645 H227R probably damaging Het
Myh4 A C 11: 67,259,300 D1861A probably damaging Het
Nup205 T C 6: 35,232,408 L1550P probably damaging Het
Olfr1218 T A 2: 89,054,619 H269L probably benign Het
Olfr1510 C T 14: 52,410,068 G268D probably benign Het
Olfr444 G T 6: 42,955,716 A73S possibly damaging Het
Olfr48 T A 2: 89,844,515 I153F probably benign Het
Olfr609 A G 7: 103,492,720 S53P possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pafah1b2 A T 9: 45,976,107 C35* probably null Het
Pappa T A 4: 65,314,593 F1323Y possibly damaging Het
Phtf2 A T 5: 20,774,073 F519Y probably damaging Het
Pigk T C 3: 152,766,513 I354T possibly damaging Het
Plekha7 T C 7: 116,124,805 D1265G possibly damaging Het
Prss12 A G 3: 123,505,501 R641G probably benign Het
Prss28 A G 17: 25,309,743 Y53C probably damaging Het
Rabgap1 G T 2: 37,561,896 C936F possibly damaging Het
Rap1a T C 3: 105,732,069 I91M possibly damaging Het
Rap1gap2 A T 11: 74,392,237 M679K probably damaging Het
Rapgef5 T A 12: 117,728,738 L352I probably damaging Het
Rhbdl3 G A 11: 80,331,889 V255M probably benign Het
Rhot1 T C 11: 80,251,170 probably benign Het
Rita1 A C 5: 120,609,561 V224G probably benign Het
Ryr2 T A 13: 11,687,902 Y2900F probably damaging Het
Scamp4 T A 10: 80,612,421 S159T probably benign Het
Setd5 T A 6: 113,128,490 Y828N probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sipa1l2 A G 8: 125,473,536 S684P probably damaging Het
Stard9 A T 2: 120,713,558 I4446F probably damaging Het
Sult1c2 T C 17: 53,831,898 D217G probably benign Het
Supt16 C A 14: 52,182,196 K148N probably benign Het
Syne3 G A 12: 104,946,992 S570L probably benign Het
Tcf3 G T 10: 80,413,044 D534E probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trbv3 T C 6: 41,048,401 I3T probably benign Het
Trbv4 T A 6: 41,059,629 Y29* probably null Het
Ttl A G 2: 129,075,984 N122S probably benign Het
Txndc11 T C 16: 11,075,071 T932A probably benign Het
Ube2e2 G A 14: 18,586,910 A150V probably damaging Het
Ube2ql1 T C 13: 69,739,340 M1V probably null Het
Uqcrc1 A G 9: 108,947,486 probably benign Het
Utrn T C 10: 12,486,483 D2702G probably damaging Het
Vcan T A 13: 89,692,691 D618V probably damaging Het
Vdac3-ps1 A G 13: 18,031,202 noncoding transcript Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zap70 G A 1: 36,770,949 V47M probably damaging Het
Zfp770 A G 2: 114,197,546 M14T possibly damaging Het
Zufsp C T 10: 33,949,462 G8D probably damaging Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96418580 missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96420480 missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96419126 missense probably benign 0.04
IGL01547:Scaf11 APN 15 96418429 missense probably benign 0.14
IGL01697:Scaf11 APN 15 96423623 splice site probably benign
IGL01780:Scaf11 APN 15 96420844 missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96418756 missense probably benign 0.01
IGL02740:Scaf11 APN 15 96419002 missense probably benign 0.01
IGL02805:Scaf11 APN 15 96420182 missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96420183 splice site probably null
R0173:Scaf11 UTSW 15 96420194 missense probably benign 0.00
R0379:Scaf11 UTSW 15 96431816 missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96420487 missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96418458 missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96418641 nonsense probably null
R0727:Scaf11 UTSW 15 96419443 missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96418689 missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96423553 missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96431825 missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96418295 missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96418840 nonsense probably null
R2092:Scaf11 UTSW 15 96415827 missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96419315 missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96420523 missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96414864 missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96418536 missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96446515 missense probably benign 0.00
R4424:Scaf11 UTSW 15 96418428 missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96424838 missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96420100 splice site probably null
R4647:Scaf11 UTSW 15 96420100 splice site probably null
R4724:Scaf11 UTSW 15 96414848 missense probably benign 0.40
R4748:Scaf11 UTSW 15 96420421 nonsense probably null
R4926:Scaf11 UTSW 15 96418242 missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96415917 missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96420432 missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96419542 missense probably benign 0.26
R5277:Scaf11 UTSW 15 96419226 missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96417120 missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96419458 missense probably benign 0.28
R5481:Scaf11 UTSW 15 96420617 missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96417081 missense probably benign 0.14
R6123:Scaf11 UTSW 15 96420454 missense probably benign 0.29
R6166:Scaf11 UTSW 15 96424662 missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96419460 splice site probably null
R6863:Scaf11 UTSW 15 96419419 missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96420328 missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96419161 missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96420387 missense possibly damaging 0.92
R7790:Scaf11 UTSW 15 96419061 missense possibly damaging 0.60
R8056:Scaf11 UTSW 15 96414817 nonsense probably null
R8104:Scaf11 UTSW 15 96418602 missense probably benign 0.34
R8129:Scaf11 UTSW 15 96419469 missense probably damaging 1.00
R8134:Scaf11 UTSW 15 96420711 missense probably damaging 1.00
R8523:Scaf11 UTSW 15 96419107 missense probably damaging 1.00
R8743:Scaf11 UTSW 15 96415788 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGACAGCTGCTCTTGGTGTTC -3'
(R):5'- TTCCCCTCCAGCTGAATCAG -3'

Sequencing Primer
(F):5'- TGGTGTTCTGCTGAATCCC -3'
(R):5'- ATCATCTAGCGATTCAGTAGAGG -3'
Posted On2017-02-28