Incidental Mutation 'R0563:Itsn1'
ID46031
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Nameintersectin 1 (SH3 domain protein 1A)
SynonymsIntersectin-L, EHSH1, Eh domain, SH3 domain regulator of endocytosis 1, Ese1, Sh3p17
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91729281-91920597 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 91820796 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056482] [ENSMUST00000064797] [ENSMUST00000095909] [ENSMUST00000113993] [ENSMUST00000113996] [ENSMUST00000113999] [ENSMUST00000114001] [ENSMUST00000114002] [ENSMUST00000135057] [ENSMUST00000159295]
Predicted Effect unknown
Transcript: ENSMUST00000056482
AA Change: T524A
SMART Domains Protein: ENSMUSP00000056011
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000064797
AA Change: T524A
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000095909
AA Change: T524A
SMART Domains Protein: ENSMUSP00000093598
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 607 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113993
AA Change: T524A
SMART Domains Protein: ENSMUSP00000109626
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1004 1064 2.46e-16 SMART
SH3 1085 1140 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113996
AA Change: T524A
SMART Domains Protein: ENSMUSP00000109629
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 999 1059 2.46e-16 SMART
SH3 1080 1135 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113999
AA Change: T524A
SMART Domains Protein: ENSMUSP00000109632
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114001
AA Change: T487A
SMART Domains Protein: ENSMUSP00000109634
Gene: ENSMUSG00000022957
AA Change: T487A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 145 155 N/A INTRINSIC
EH 177 272 2.55e-49 SMART
EFh 221 249 1.77e-2 SMART
low complexity region 293 305 N/A INTRINSIC
coiled coil region 315 410 N/A INTRINSIC
coiled coil region 431 478 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
coiled coil region 524 624 N/A INTRINSIC
low complexity region 650 659 N/A INTRINSIC
SH3 704 761 1.05e-19 SMART
SH3 872 926 2.64e-16 SMART
SH3 961 1015 1.82e-19 SMART
SH3 1033 1093 2.46e-16 SMART
SH3 1114 1169 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114002
AA Change: T524A
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957
AA Change: T524A

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133389
Predicted Effect probably benign
Transcript: ENSMUST00000135057
SMART Domains Protein: ENSMUSP00000117018
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 121 131 N/A INTRINSIC
EH 153 248 2.55e-49 SMART
EFh 197 225 1.77e-2 SMART
low complexity region 269 281 N/A INTRINSIC
coiled coil region 291 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151044
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91806201 unclassified probably benign
IGL01799:Itsn1 APN 16 91848882 missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91815407 missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91820676 intron probably benign
IGL02503:Itsn1 APN 16 91889204 missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91899623 missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91820718 intron probably benign
IGL03007:Itsn1 APN 16 91784162 splice site probably benign
IGL03223:Itsn1 APN 16 91905306 missense probably benign 0.00
raphael UTSW 16 91820796 intron probably benign
weevil UTSW 16 91818552 intron probably benign
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0255:Itsn1 UTSW 16 91806090 unclassified probably benign
R0432:Itsn1 UTSW 16 91815520 missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91868148 intron probably benign
R0471:Itsn1 UTSW 16 91899589 missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91899623 missense possibly damaging 0.79
R1657:Itsn1 UTSW 16 91909223 missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91812150 missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91816959 critical splice donor site probably null
R1859:Itsn1 UTSW 16 91889154 intron probably benign
R1898:Itsn1 UTSW 16 91899580 missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91905501 critical splice donor site probably null
R2221:Itsn1 UTSW 16 91853768 intron probably benign
R2244:Itsn1 UTSW 16 91853771 missense probably null
R3160:Itsn1 UTSW 16 91853044 nonsense probably null
R3162:Itsn1 UTSW 16 91853044 nonsense probably null
R3814:Itsn1 UTSW 16 91852921 missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91852902 missense probably benign 0.00
R4254:Itsn1 UTSW 16 91818552 intron probably benign
R4319:Itsn1 UTSW 16 91818552 intron probably benign
R4321:Itsn1 UTSW 16 91818552 intron probably benign
R4323:Itsn1 UTSW 16 91818552 intron probably benign
R4326:Itsn1 UTSW 16 91853855 intron probably benign
R4515:Itsn1 UTSW 16 91899649 missense probably damaging 0.99
R4584:Itsn1 UTSW 16 91820583 intron probably benign
R4600:Itsn1 UTSW 16 91899587 missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91841588 missense probably damaging 1.00
R4834:Itsn1 UTSW 16 91906789 nonsense probably null
R4868:Itsn1 UTSW 16 91785317 missense probably damaging 0.98
R5036:Itsn1 UTSW 16 91782235 splice site probably benign
R5122:Itsn1 UTSW 16 91893844 intron probably benign
R5161:Itsn1 UTSW 16 91908838 missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91818591 intron probably benign
R5538:Itsn1 UTSW 16 91784102 missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91905380 missense probably benign 0.00
R5697:Itsn1 UTSW 16 91801589 missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91906855 missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91853011 missense probably benign 0.01
R6148:Itsn1 UTSW 16 91816852 missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91868096 intron probably benign
R6524:Itsn1 UTSW 16 91911995 missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91868050 missense unknown
R7261:Itsn1 UTSW 16 91905306 missense probably benign 0.00
R7320:Itsn1 UTSW 16 91839699 missense unknown
R7366:Itsn1 UTSW 16 91908450 missense unknown
R7462:Itsn1 UTSW 16 91853185 missense possibly damaging 0.53
R7665:Itsn1 UTSW 16 91841603 missense unknown
R7720:Itsn1 UTSW 16 91868083 missense unknown
R7856:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7864:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7896:Itsn1 UTSW 16 91818558 missense unknown
R7897:Itsn1 UTSW 16 91818558 missense unknown
R7939:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7947:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7979:Itsn1 UTSW 16 91818558 missense unknown
R7980:Itsn1 UTSW 16 91818558 missense unknown
R7998:Itsn1 UTSW 16 91850936 missense unknown
Predicted Primers PCR Primer
(F):5'- CGACAACTTGAATGGGAACGGAACC -3'
(R):5'- ACCTTGCCCACAGCAGTGTTAG -3'

Sequencing Primer
(F):5'- CGGAGACAGGAACTCCTGAATC -3'
(R):5'- CCCACAGCAGTGTTAGGAGAC -3'
Posted On2013-06-11