Incidental Mutation 'R5941:Gucy2g'
ID460315
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission 044133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5941 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55215131 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 745 (D745G)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably damaging
Transcript: ENSMUST00000069183
AA Change: D745G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: D745G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,591,098 D70E probably damaging Het
Adamts14 C T 10: 61,221,895 G561R probably damaging Het
Alpk3 A T 7: 81,078,653 K510N probably damaging Het
Ap3b1 A G 13: 94,440,273 N269D probably benign Het
Ap3b1 T C 13: 94,483,265 S144P probably damaging Het
Apba2 C A 7: 64,745,716 Q635K probably benign Het
Aspg C T 12: 112,113,085 T99I probably benign Het
Atp7b A G 8: 21,997,496 V1179A probably damaging Het
Bbs12 T C 3: 37,320,048 V215A probably damaging Het
Bcl2l11 C A 2: 128,127,783 probably benign Het
Bglap3 T G 3: 88,376,346 probably benign Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cdh26 C T 2: 178,481,650 Q662* probably null Het
Cftr T A 6: 18,313,646 F1290I probably damaging Het
Clip3 G A 7: 30,292,306 E36K probably damaging Het
Cog2 A G 8: 124,546,086 I541V probably benign Het
Cpt1b A T 15: 89,425,214 W39R probably damaging Het
Csmd1 A G 8: 15,932,471 V2732A probably damaging Het
Dlec1 A G 9: 119,126,312 D688G probably damaging Het
Dnah12 A G 14: 26,706,867 E216G probably benign Het
Dnah7b C A 1: 46,187,290 L1294I probably damaging Het
Duox1 T A 2: 122,344,156 L1265Q probably damaging Het
Fam91a1 T A 15: 58,431,317 D358E probably benign Het
Fat3 A C 9: 15,999,501 I1735S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabrr1 T A 4: 33,162,676 M414K probably benign Het
Gm21915 A C 9: 40,670,699 E29D possibly damaging Het
Gm340 G A 19: 41,586,400 R1198Q probably damaging Het
Gm9955 G A 18: 24,709,263 probably benign Het
Gpat2 C A 2: 127,428,275 D69E possibly damaging Het
Grin2b T G 6: 135,736,373 I837L probably damaging Het
H2-Q1 A G 17: 35,321,356 Y139C probably damaging Het
Ints2 G C 11: 86,250,972 N216K probably benign Het
Jmy G A 13: 93,498,825 P161L probably benign Het
Kctd11 G A 11: 69,879,973 R80W possibly damaging Het
Kif7 A G 7: 79,711,132 probably benign Het
Kifc1 C T 17: 33,883,085 probably benign Het
Mir412 C A 12: 109,743,299 noncoding transcript Het
Mknk1 T A 4: 115,876,637 probably benign Het
Mmp16 A G 4: 18,054,354 probably benign Het
Mmp7 A G 9: 7,697,645 H227R probably damaging Het
Myh4 A C 11: 67,259,300 D1861A probably damaging Het
Nup205 T C 6: 35,232,408 L1550P probably damaging Het
Olfr1218 T A 2: 89,054,619 H269L probably benign Het
Olfr1510 C T 14: 52,410,068 G268D probably benign Het
Olfr444 G T 6: 42,955,716 A73S possibly damaging Het
Olfr48 T A 2: 89,844,515 I153F probably benign Het
Olfr609 A G 7: 103,492,720 S53P possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pafah1b2 A T 9: 45,976,107 C35* probably null Het
Pappa T A 4: 65,314,593 F1323Y possibly damaging Het
Phtf2 A T 5: 20,774,073 F519Y probably damaging Het
Pigk T C 3: 152,766,513 I354T possibly damaging Het
Plekha7 T C 7: 116,124,805 D1265G possibly damaging Het
Prss12 A G 3: 123,505,501 R641G probably benign Het
Prss28 A G 17: 25,309,743 Y53C probably damaging Het
Rabgap1 G T 2: 37,561,896 C936F possibly damaging Het
Rap1a T C 3: 105,732,069 I91M possibly damaging Het
Rap1gap2 A T 11: 74,392,237 M679K probably damaging Het
Rapgef5 T A 12: 117,728,738 L352I probably damaging Het
Rhbdl3 G A 11: 80,331,889 V255M probably benign Het
Rhot1 T C 11: 80,251,170 probably benign Het
Rita1 A C 5: 120,609,561 V224G probably benign Het
Ryr2 T A 13: 11,687,902 Y2900F probably damaging Het
Scaf11 A C 15: 96,420,308 H458Q probably damaging Het
Scamp4 T A 10: 80,612,421 S159T probably benign Het
Setd5 T A 6: 113,128,490 Y828N probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sipa1l2 A G 8: 125,473,536 S684P probably damaging Het
Stard9 A T 2: 120,713,558 I4446F probably damaging Het
Sult1c2 T C 17: 53,831,898 D217G probably benign Het
Supt16 C A 14: 52,182,196 K148N probably benign Het
Syne3 G A 12: 104,946,992 S570L probably benign Het
Tcf3 G T 10: 80,413,044 D534E probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trbv3 T C 6: 41,048,401 I3T probably benign Het
Trbv4 T A 6: 41,059,629 Y29* probably null Het
Ttl A G 2: 129,075,984 N122S probably benign Het
Txndc11 T C 16: 11,075,071 T932A probably benign Het
Ube2e2 G A 14: 18,586,910 A150V probably damaging Het
Ube2ql1 T C 13: 69,739,340 M1V probably null Het
Uqcrc1 A G 9: 108,947,486 probably benign Het
Utrn T C 10: 12,486,483 D2702G probably damaging Het
Vcan T A 13: 89,692,691 D618V probably damaging Het
Vdac3-ps1 A G 13: 18,031,202 noncoding transcript Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zap70 G A 1: 36,770,949 V47M probably damaging Het
Zfp770 A G 2: 114,197,546 M14T possibly damaging Het
Zufsp C T 10: 33,949,462 G8D probably damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R7963:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTCACAGAGGCTTCCGG -3'
(R):5'- TTTCCCAGGCAGACTCTCAC -3'

Sequencing Primer
(F):5'- GGCTTCATCAGAGGCTGTAAAAACC -3'
(R):5'- AGGCAGACTCTCACAGGGC -3'
Posted On2017-02-28