Mutagenetix > Incidental Mutation

Incidental Mutation 'R5941:Gucy2g'

460315

Institutional Source

Beutler Lab

Gene Symbol

Gucy2g

Ensembl Gene

ENSMUSG00000055523

Gene Name

guanylate cyclase 2g

Synonyms

GC-G, 2410077I05Rik

MMRRC Submission

044133-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5941 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55198297-55241236 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55215131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 745 (D745G)

Ref Sequence

ENSEMBL: ENSMUSP00000068253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069183]

AlphaFold

Q6TL19

Predicted Effect

probably damaging
Transcript: ENSMUST00000069183
AA Change: D745G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: D745G

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
Pfam:ANF_receptor	65	416	5.2e-36	PFAM
low complexity region	471	487	N/A	INTRINSIC
Pfam:Pkinase	574	826	2e-26	PFAM
Pfam:Pkinase_Tyr	577	826	6e-35	PFAM
CYCc	865	1059	6.42e-96	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.2%

Validation Efficiency

97% (95/98)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,591,098	D70E	probably damaging	Het
Adamts14	C	T	10: 61,221,895	G561R	probably damaging	Het
Alpk3	A	T	7: 81,078,653	K510N	probably damaging	Het
Ap3b1	A	G	13: 94,440,273	N269D	probably benign	Het
Ap3b1	T	C	13: 94,483,265	S144P	probably damaging	Het
Apba2	C	A	7: 64,745,716	Q635K	probably benign	Het
Aspg	C	T	12: 112,113,085	T99I	probably benign	Het
Atp7b	A	G	8: 21,997,496	V1179A	probably damaging	Het
Bbs12	T	C	3: 37,320,048	V215A	probably damaging	Het
Bcl2l11	C	A	2: 128,127,783		probably benign	Het
Bglap3	T	G	3: 88,376,346		probably benign	Het
Cchcr1	G	A	17: 35,524,993	R284Q	probably damaging	Het
Cdh26	C	T	2: 178,481,650	Q662*	probably null	Het
Cftr	T	A	6: 18,313,646	F1290I	probably damaging	Het
Clip3	G	A	7: 30,292,306	E36K	probably damaging	Het
Cog2	A	G	8: 124,546,086	I541V	probably benign	Het
Cpt1b	A	T	15: 89,425,214	W39R	probably damaging	Het
Csmd1	A	G	8: 15,932,471	V2732A	probably damaging	Het
Dlec1	A	G	9: 119,126,312	D688G	probably damaging	Het
Dnah12	A	G	14: 26,706,867	E216G	probably benign	Het
Dnah7b	C	A	1: 46,187,290	L1294I	probably damaging	Het
Duox1	T	A	2: 122,344,156	L1265Q	probably damaging	Het
Fam91a1	T	A	15: 58,431,317	D358E	probably benign	Het
Fat3	A	C	9: 15,999,501	I1735S	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabrr1	T	A	4: 33,162,676	M414K	probably benign	Het
Gm21915	A	C	9: 40,670,699	E29D	possibly damaging	Het
Gm340	G	A	19: 41,586,400	R1198Q	probably damaging	Het
Gm9955	G	A	18: 24,709,263		probably benign	Het
Gpat2	C	A	2: 127,428,275	D69E	possibly damaging	Het
Grin2b	T	G	6: 135,736,373	I837L	probably damaging	Het
H2-Q1	A	G	17: 35,321,356	Y139C	probably damaging	Het
Ints2	G	C	11: 86,250,972	N216K	probably benign	Het
Jmy	G	A	13: 93,498,825	P161L	probably benign	Het
Kctd11	G	A	11: 69,879,973	R80W	possibly damaging	Het
Kif7	A	G	7: 79,711,132		probably benign	Het
Kifc1	C	T	17: 33,883,085		probably benign	Het
Mir412	C	A	12: 109,743,299		noncoding transcript	Het
Mknk1	T	A	4: 115,876,637		probably benign	Het
Mmp16	A	G	4: 18,054,354		probably benign	Het
Mmp7	A	G	9: 7,697,645	H227R	probably damaging	Het
Myh4	A	C	11: 67,259,300	D1861A	probably damaging	Het
Nup205	T	C	6: 35,232,408	L1550P	probably damaging	Het
Olfr1218	T	A	2: 89,054,619	H269L	probably benign	Het
Olfr1510	C	T	14: 52,410,068	G268D	probably benign	Het
Olfr444	G	T	6: 42,955,716	A73S	possibly damaging	Het
Olfr48	T	A	2: 89,844,515	I153F	probably benign	Het
Olfr609	A	G	7: 103,492,720	S53P	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pafah1b2	A	T	9: 45,976,107	C35*	probably null	Het
Pappa	T	A	4: 65,314,593	F1323Y	possibly damaging	Het
Phtf2	A	T	5: 20,774,073	F519Y	probably damaging	Het
Pigk	T	C	3: 152,766,513	I354T	possibly damaging	Het
Plekha7	T	C	7: 116,124,805	D1265G	possibly damaging	Het
Prss12	A	G	3: 123,505,501	R641G	probably benign	Het
Prss28	A	G	17: 25,309,743	Y53C	probably damaging	Het
Rabgap1	G	T	2: 37,561,896	C936F	possibly damaging	Het
Rap1a	T	C	3: 105,732,069	I91M	possibly damaging	Het
Rap1gap2	A	T	11: 74,392,237	M679K	probably damaging	Het
Rapgef5	T	A	12: 117,728,738	L352I	probably damaging	Het
Rhbdl3	G	A	11: 80,331,889	V255M	probably benign	Het
Rhot1	T	C	11: 80,251,170		probably benign	Het
Rita1	A	C	5: 120,609,561	V224G	probably benign	Het
Ryr2	T	A	13: 11,687,902	Y2900F	probably damaging	Het
Scaf11	A	C	15: 96,420,308	H458Q	probably damaging	Het
Scamp4	T	A	10: 80,612,421	S159T	probably benign	Het
Setd5	T	A	6: 113,128,490	Y828N	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Sipa1l2	A	G	8: 125,473,536	S684P	probably damaging	Het
Stard9	A	T	2: 120,713,558	I4446F	probably damaging	Het
Sult1c2	T	C	17: 53,831,898	D217G	probably benign	Het
Supt16	C	A	14: 52,182,196	K148N	probably benign	Het
Syne3	G	A	12: 104,946,992	S570L	probably benign	Het
Tcf3	G	T	10: 80,413,044	D534E	probably benign	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Trbv3	T	C	6: 41,048,401	I3T	probably benign	Het
Trbv4	T	A	6: 41,059,629	Y29*	probably null	Het
Ttl	A	G	2: 129,075,984	N122S	probably benign	Het
Txndc11	T	C	16: 11,075,071	T932A	probably benign	Het
Ube2e2	G	A	14: 18,586,910	A150V	probably damaging	Het
Ube2ql1	T	C	13: 69,739,340	M1V	probably null	Het
Uqcrc1	A	G	9: 108,947,486		probably benign	Het
Utrn	T	C	10: 12,486,483	D2702G	probably damaging	Het
Vcan	T	A	13: 89,692,691	D618V	probably damaging	Het
Vdac3-ps1	A	G	13: 18,031,202		noncoding transcript	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zap70	G	A	1: 36,770,949	V47M	probably damaging	Het
Zfp770	A	G	2: 114,197,546	M14T	possibly damaging	Het
Zufsp	C	T	10: 33,949,462	G8D	probably damaging	Het

Other mutations in Gucy2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Gucy2g	APN	19	55233103	missense	probably benign	0.01
IGL01954:Gucy2g	APN	19	55198691	missense	probably benign	0.01
IGL01969:Gucy2g	APN	19	55227438	missense	probably benign	0.00
IGL02164:Gucy2g	APN	19	55238023	missense	probably benign
IGL02534:Gucy2g	APN	19	55241068	missense	probably damaging	1.00
IGL02667:Gucy2g	APN	19	55206177	missense	possibly damaging	0.64
IGL02755:Gucy2g	APN	19	55210354	missense	probably benign	0.10
IGL03187:Gucy2g	APN	19	55231052	missense	possibly damaging	0.91
IGL03354:Gucy2g	APN	19	55233080	missense	possibly damaging	0.95
PIT4366001:Gucy2g	UTSW	19	55237782	missense	probably null	0.51
R0040:Gucy2g	UTSW	19	55217302	missense	possibly damaging	0.73
R0126:Gucy2g	UTSW	19	55241166	missense	probably benign
R0318:Gucy2g	UTSW	19	55237798	missense	probably benign	0.00
R0576:Gucy2g	UTSW	19	55198770	missense	probably damaging	1.00
R0604:Gucy2g	UTSW	19	55203087	missense	probably benign	0.00
R0962:Gucy2g	UTSW	19	55210284	nonsense	probably null
R1348:Gucy2g	UTSW	19	55222906	missense	possibly damaging	0.68
R1458:Gucy2g	UTSW	19	55215036	splice site	probably benign
R1693:Gucy2g	UTSW	19	55222926	missense	probably damaging	1.00
R1795:Gucy2g	UTSW	19	55199541	missense	probably damaging	1.00
R1804:Gucy2g	UTSW	19	55210309	missense	probably benign	0.34
R1830:Gucy2g	UTSW	19	55222930	missense	possibly damaging	0.94
R1902:Gucy2g	UTSW	19	55210237	missense	probably benign	0.20
R1927:Gucy2g	UTSW	19	55237759	missense	probably benign	0.02
R1969:Gucy2g	UTSW	19	55222896	missense	possibly damaging	0.90
R1969:Gucy2g	UTSW	19	55233053	missense	probably benign	0.42
R2071:Gucy2g	UTSW	19	55222340	missense	possibly damaging	0.72
R2842:Gucy2g	UTSW	19	55240947	missense	probably damaging	1.00
R2971:Gucy2g	UTSW	19	55210276	missense	probably damaging	1.00
R4202:Gucy2g	UTSW	19	55229769	missense	possibly damaging	0.96
R4405:Gucy2g	UTSW	19	55237837	missense	probably benign	0.08
R4407:Gucy2g	UTSW	19	55237837	missense	probably benign	0.08
R4614:Gucy2g	UTSW	19	55202147	nonsense	probably null
R4671:Gucy2g	UTSW	19	55238068	missense	probably damaging	1.00
R4684:Gucy2g	UTSW	19	55206256	missense	probably damaging	1.00
R4837:Gucy2g	UTSW	19	55226053	missense	probably benign
R4969:Gucy2g	UTSW	19	55226013	missense	probably benign
R5050:Gucy2g	UTSW	19	55240935	missense	probably benign	0.05
R5059:Gucy2g	UTSW	19	55226071	missense	probably benign	0.00
R5070:Gucy2g	UTSW	19	55229787	missense	probably damaging	0.98
R5288:Gucy2g	UTSW	19	55215116	missense	probably damaging	1.00
R5384:Gucy2g	UTSW	19	55215116	missense	probably damaging	1.00
R5386:Gucy2g	UTSW	19	55215116	missense	probably damaging	1.00
R5497:Gucy2g	UTSW	19	55198701	missense	probably benign	0.00
R5531:Gucy2g	UTSW	19	55241140	missense	probably benign	0.24
R5536:Gucy2g	UTSW	19	55237927	missense	probably benign	0.05
R5679:Gucy2g	UTSW	19	55231079	missense	possibly damaging	0.87
R5715:Gucy2g	UTSW	19	55233155	missense	possibly damaging	0.93
R6250:Gucy2g	UTSW	19	55217424	missense	probably damaging	0.99
R6288:Gucy2g	UTSW	19	55227513	missense	probably benign	0.01
R6378:Gucy2g	UTSW	19	55240945	missense	probably benign	0.00
R6605:Gucy2g	UTSW	19	55241028	missense	probably damaging	1.00
R7020:Gucy2g	UTSW	19	55233050	missense	probably damaging	0.98
R7064:Gucy2g	UTSW	19	55210332	missense	probably benign	0.01
R7078:Gucy2g	UTSW	19	55241151	missense	probably damaging	1.00
R7402:Gucy2g	UTSW	19	55206293	missense	probably damaging	1.00
R7539:Gucy2g	UTSW	19	55203154	missense	probably damaging	0.99
R7561:Gucy2g	UTSW	19	55206340	missense	probably benign	0.38
R7583:Gucy2g	UTSW	19	55235615	missense	probably damaging	1.00
R7804:Gucy2g	UTSW	19	55228152	missense	probably benign	0.02
R7880:Gucy2g	UTSW	19	55206280	missense	probably damaging	1.00
R8442:Gucy2g	UTSW	19	55217401	missense	probably benign	0.00
R8559:Gucy2g	UTSW	19	55210354	missense	probably benign	0.10
R8970:Gucy2g	UTSW	19	55203046	missense	possibly damaging	0.56
R8972:Gucy2g	UTSW	19	55237974	missense	probably benign	0.17
R9085:Gucy2g	UTSW	19	55233165	nonsense	probably null
R9390:Gucy2g	UTSW	19	55202175	missense	probably null	1.00
R9462:Gucy2g	UTSW	19	55233037	critical splice donor site	probably null
R9502:Gucy2g	UTSW	19	55210384	missense	probably damaging	1.00
R9610:Gucy2g	UTSW	19	55206173	missense	probably damaging	1.00
R9611:Gucy2g	UTSW	19	55206173	missense	probably damaging	1.00
R9644:Gucy2g	UTSW	19	55231105	missense	probably benign	0.05
Z1177:Gucy2g	UTSW	19	55210377	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACATTCACAGAGGCTTCCGG -3'
(R):5'- TTTCCCAGGCAGACTCTCAC -3'

Sequencing Primer
(F):5'- GGCTTCATCAGAGGCTGTAAAAACC -3'
(R):5'- AGGCAGACTCTCACAGGGC -3'

Posted On

2017-02-28