Incidental Mutation 'R0563:Hsf2bp'
ID46034
Institutional Source Beutler Lab
Gene Symbol Hsf2bp
Ensembl Gene ENSMUSG00000002076
Gene Nameheat shock transcription factor 2 binding protein
Synonyms
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31944769-32034508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32007718 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 221 (L221Q)
Ref Sequence ENSEMBL: ENSMUSP00000002145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002145]
Predicted Effect probably damaging
Transcript: ENSMUST00000002145
AA Change: L221Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002145
Gene: ENSMUSG00000002076
AA Change: L221Q

DomainStartEndE-ValueType
coiled coil region 50 126 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
SCOP:d1gw5a_ 252 329 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133308
AA Change: L98Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115909
Gene: ENSMUSG00000002076
AA Change: L98Q

DomainStartEndE-ValueType
transmembrane domain 64 86 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138172
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HSF2 binding protein (HSF2BP) associates with HSF2. The interaction occurs between the trimerization domain of HSF2 and the amino terminal hydrophilic region of HSF2BP that comprises two leucine zipper motifs. HSF2BP may therefore be involved in modulating HSF2 activation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Hsf2bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Hsf2bp APN 17 31987404 missense probably damaging 1.00
IGL03274:Hsf2bp APN 17 32007770 missense probably damaging 1.00
R0632:Hsf2bp UTSW 17 32013346 missense probably damaging 1.00
R0960:Hsf2bp UTSW 17 32007769 missense probably damaging 1.00
R1967:Hsf2bp UTSW 17 31987404 nonsense probably null
R4375:Hsf2bp UTSW 17 31987348 missense probably null 1.00
R4567:Hsf2bp UTSW 17 31946734 missense probably benign 0.01
R5510:Hsf2bp UTSW 17 31946747 missense unknown
R5546:Hsf2bp UTSW 17 31946695 missense probably damaging 0.98
R5988:Hsf2bp UTSW 17 32011175 critical splice donor site probably null
R7026:Hsf2bp UTSW 17 32033280 missense possibly damaging 0.93
R7459:Hsf2bp UTSW 17 31946734 missense probably benign 0.01
R7790:Hsf2bp UTSW 17 32034479 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTGCCTCCTGGTTTGTTAGAAC -3'
(R):5'- TGAACTCTGCAAGCAGCACTGTG -3'

Sequencing Primer
(F):5'- GAACTGCTGGATCAACTGTTTACG -3'
(R):5'- GATTTTCCAGAATGTGAAGCACCC -3'
Posted On2013-06-11