Incidental Mutation 'R5942:Enpp1'
ID460355
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5942 (G1)
Quality Score187
Status Not validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 24676068 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 138 (E138*)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably null
Transcript: ENSMUST00000039882
AA Change: E138*
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370
AA Change: E138*

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105520
AA Change: E138*
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: E138*

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135846
AA Change: E138*
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: E138*

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Gpr156 C T 16: 38,004,902 P494S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Ncaph C A 2: 127,116,688 probably null Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1098 T C 2: 86,923,406 N42S probably damaging Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdha1 T A 18: 36,930,391 V36D probably damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 T32A probably benign Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 splice site probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
R7789:Enpp1 UTSW 10 24654083 splice site probably null
R8073:Enpp1 UTSW 10 24679244 missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24674656 missense probably benign 0.25
R8955:Enpp1 UTSW 10 24669028 missense probably benign 0.01
Z1177:Enpp1 UTSW 10 24661942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTCTGAGAAAAGACGGTGC -3'
(R):5'- ATTACTGCTAGGTGCCTGC -3'

Sequencing Primer
(F):5'- AAAGACGGTGCCGATGC -3'
(R):5'- CCATCTGTTAGCTCAGAAAGGCTG -3'
Posted On2017-02-28