Incidental Mutation 'R0563:Nelfe'
ID46036
Institutional Source Beutler Lab
Gene Symbol Nelfe
Ensembl Gene ENSMUSG00000024369
Gene Namenegative elongation factor complex member E, Rdbp
SynonymsRdbp, NELF-E
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34850391-34856372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34854239 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 250 (E250G)
Ref Sequence ENSEMBL: ENSMUSP00000134272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000046022] [ENSMUST00000097343] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000153400] [ENSMUST00000154526] [ENSMUST00000165953] [ENSMUST00000172966] [ENSMUST00000173065] [ENSMUST00000173357] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046022
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097343
AA Change: E250G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369
AA Change: E250G

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128767
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129891
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146299
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165953
AA Change: E250G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369
AA Change: E250G

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect probably benign
Transcript: ENSMUST00000173065
SMART Domains Protein: ENSMUSP00000133934
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173357
AA Change: E250G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369
AA Change: E250G

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174888
Predicted Effect probably benign
Transcript: ENSMUST00000176203
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Meta Mutation Damage Score 0.2221 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex termed negative elongation factor (NELF) which represses RNA polymerase II transcript elongation. This protein bears similarity to nuclear RNA-binding proteins; however, it has not been demonstrated that this protein binds RNA. The protein contains a tract of alternating basic and acidic residues, largely arginine (R) and aspartic acid (D). The gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Nelfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Nelfe APN 17 34853616 missense possibly damaging 0.81
IGL02227:Nelfe APN 17 34854354 missense probably benign 0.09
FR4342:Nelfe UTSW 17 34854089 unclassified probably benign
FR4548:Nelfe UTSW 17 34854070 unclassified probably benign
R0007:Nelfe UTSW 17 34853986 unclassified probably benign
R2213:Nelfe UTSW 17 34853883 missense probably benign 0.03
R3802:Nelfe UTSW 17 34853901 missense possibly damaging 0.93
R5892:Nelfe UTSW 17 34854669 unclassified probably benign
R6318:Nelfe UTSW 17 34854456 missense probably damaging 1.00
R6625:Nelfe UTSW 17 34854358 missense probably benign 0.44
R6977:Nelfe UTSW 17 34854712 missense probably damaging 1.00
R7106:Nelfe UTSW 17 34852419 splice site probably null
R7205:Nelfe UTSW 17 34850936 synonymous probably null
RF055:Nelfe UTSW 17 34854062 unclassified probably benign
RF056:Nelfe UTSW 17 34854071 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTATGAAGAGCATGGTAGCGCC -3'
(R):5'- AGGAACGGTCTGAGAAGTCCCAAC -3'

Sequencing Primer
(F):5'- gggacaaagagagagacagag -3'
(R):5'- CTTCTCGTAGGTGACGAAGGC -3'
Posted On2013-06-11