Mutagenetix > Incidental Mutations

Incidental Mutation 'R5942:Rimbp3'

460370

Institutional Source

Beutler Lab

Gene Symbol

Rimbp3

Ensembl Gene

ENSMUSG00000071636

Gene Name

RIMS binding protein 3

Synonyms

RIM-BP3, LOC239731, LOC385766

MMRRC Submission

044134-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.247) question?

Stock #

R5942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17208603-17213982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17211888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1059 (T1059A)

Ref Sequence

ENSEMBL: ENSMUSP00000127909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169803]

AlphaFold

Q3V0F0

Predicted Effect

probably benign
Transcript: ENSMUST00000169803
AA Change: T1059A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: T1059A

Domain	Start	End	E-Value	Type
coiled coil region	25	56	N/A	INTRINSIC
coiled coil region	84	145	N/A	INTRINSIC
low complexity region	308	324	N/A	INTRINSIC
coiled coil region	395	431	N/A	INTRINSIC
coiled coil region	547	610	N/A	INTRINSIC
low complexity region	688	701	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
SH3	825	888	7.58e-8	SMART
low complexity region	913	924	N/A	INTRINSIC
FN3	980	1052	2.21e-3	SMART
FN3	1073	1160	1.91e1	SMART
low complexity region	1236	1243	N/A	INTRINSIC
SH3	1423	1487	5.08e-2	SMART
SH3	1539	1602	5.97e-6	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 96.7%
20x: 89.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	C	T	17: 46,312,407	V860M	probably benign	Het
Accs	A	T	2: 93,836,047	L432M	probably damaging	Het
Actrt3	T	A	3: 30,598,664	N94Y	possibly damaging	Het
Adamts18	T	C	8: 113,777,748	Q80R	probably benign	Het
Ccr8	G	T	9: 120,094,706	V296F	probably damaging	Het
Cep170	T	A	1: 176,756,419	E798V	probably damaging	Het
Cttnbp2	T	A	6: 18,448,440	E73D	probably damaging	Het
Cyp2a4	A	T	7: 26,310,704		probably null	Het
Dync2h1	A	T	9: 7,117,466	Y41*	probably null	Het
Enc1	G	A	13: 97,246,379	D466N	probably benign	Het
Enpp1	C	A	10: 24,676,068	E138*	probably null	Het
Ezh2	T	C	6: 47,577,582	R27G	possibly damaging	Het
Fam189a2	A	G	19: 23,986,470	V245A	probably damaging	Het
Fut10	A	G	8: 31,201,457	N110S	possibly damaging	Het
Glt1d1	A	T	5: 127,644,470		probably null	Het
Gm14393	G	A	2: 175,061,896	Q73*	probably null	Het
Gm6904	G	A	14: 59,260,144	P13S	probably benign	Het
Gpr156	C	T	16: 38,004,902	P494S	probably benign	Het
Has2	T	A	15: 56,667,796	K508*	probably null	Het
Hc	A	T	2: 35,028,125	C715*	probably null	Het
Hook2	C	T	8: 84,994,780		probably null	Het
Klhdc7b	A	C	15: 89,387,431	I839L	probably benign	Het
Kndc1	T	C	7: 139,936,879	L1584P	probably damaging	Het
Lamp1	T	C	8: 13,173,941	F358L	probably damaging	Het
Man2a1	A	G	17: 64,625,380	K154R	probably benign	Het
Mga	A	G	2: 119,946,959	I1871V	probably benign	Het
Mgmt	T	A	7: 137,121,490	D96E	probably benign	Het
Morc2a	C	A	11: 3,679,936	T424K	probably damaging	Het
Myo1g	A	G	11: 6,514,888	L462P	probably damaging	Het
Ncaph	C	A	2: 127,116,688		probably null	Het
Nlrc3	A	T	16: 3,949,429	D969E	probably damaging	Het
Nt5c3	A	T	6: 56,897,854		probably null	Het
Olfr1098	T	C	2: 86,923,406	N42S	probably damaging	Het
Olfr1170	A	C	2: 88,224,572	I153M	probably benign	Het
Olfr1255	G	T	2: 89,816,340	E5*	probably null	Het
Olfr194	A	T	16: 59,119,676	Y131*	probably null	Het
Parp14	C	A	16: 35,839,367	M1628I	probably damaging	Het
Parp8	G	T	13: 116,869,433	P693Q	probably benign	Het
Parp9	A	G	16: 35,971,889	D485G	possibly damaging	Het
Pcdha1	T	A	18: 36,930,391	V36D	probably damaging	Het
Pcdhb5	C	T	18: 37,320,785	Q73*	probably null	Het
Pecam1	G	T	11: 106,661,983		probably benign	Het
Pex1	A	G	5: 3,610,277	I527V	probably benign	Het
Ppp4r4	T	A	12: 103,587,447	V388D	possibly damaging	Het
Psmc4	C	T	7: 28,047,055	V202I	probably damaging	Het
Ptx3	T	G	3: 66,220,063	M1R	probably null	Het
Rmdn3	G	A	2: 119,147,577	A181V	probably damaging	Het
Rnase10	A	T	14: 51,009,278	M38L	probably benign	Het
Sec16b	T	A	1: 157,531,350	Y118N	probably damaging	Het
Sigmar1	T	C	4: 41,741,159	T32A	probably benign	Het
Srcap	A	G	7: 127,538,008	D954G	probably damaging	Het
Tfrc	A	G	16: 32,626,715	N618S	possibly damaging	Het
Tnrc6a	A	G	7: 123,186,665	D1028G	probably damaging	Het
Tns3	A	T	11: 8,435,860	D1379E	probably damaging	Het
Ttn	A	T	2: 76,750,161	C23463S	possibly damaging	Het
Ufl1	T	C	4: 25,250,619	T745A	probably benign	Het
Vmn1r231	T	A	17: 20,890,155	Y166F	possibly damaging	Het
Wbp1l	C	A	19: 46,654,430	T290K	probably damaging	Het
Wdr25	A	G	12: 108,898,466	N179S	probably benign	Het
Wdr62	G	A	7: 30,243,079	Q1035*	probably null	Het
Yif1a	C	T	19: 5,091,641	R196C	probably damaging	Het
Zfp352	A	T	4: 90,225,070	K482N	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Rimbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rimbp3	APN	16	17209743	missense	probably benign	0.01
IGL00786:Rimbp3	APN	16	17211688	missense	probably damaging	0.99
IGL01411:Rimbp3	APN	16	17211094	missense	probably damaging	1.00
IGL01434:Rimbp3	APN	16	17211702	missense	probably benign	0.13
IGL01895:Rimbp3	APN	16	17211436	missense	probably damaging	0.99
IGL02322:Rimbp3	APN	16	17211615	missense	probably benign	0.00
IGL02649:Rimbp3	APN	16	17209608	nonsense	probably null
IGL03285:Rimbp3	APN	16	17213232	missense	probably benign	0.16
PIT4581001:Rimbp3	UTSW	16	17210716	missense	possibly damaging	0.76
R0279:Rimbp3	UTSW	16	17209453	missense	probably benign	0.00
R0465:Rimbp3	UTSW	16	17211780	missense	possibly damaging	0.86
R0605:Rimbp3	UTSW	16	17211699	missense	probably damaging	0.99
R0674:Rimbp3	UTSW	16	17212737	missense	probably benign	0.02
R1676:Rimbp3	UTSW	16	17211113	missense	probably benign	0.13
R1780:Rimbp3	UTSW	16	17212632	missense	probably benign
R1946:Rimbp3	UTSW	16	17210427	missense	probably benign	0.10
R2113:Rimbp3	UTSW	16	17209675	missense	probably benign	0.00
R3847:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3849:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3850:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R4355:Rimbp3	UTSW	16	17209692	missense	possibly damaging	0.56
R4646:Rimbp3	UTSW	16	17213098	missense	probably damaging	0.99
R4669:Rimbp3	UTSW	16	17209189	missense	possibly damaging	0.88
R4732:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R4733:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R5025:Rimbp3	UTSW	16	17209807	missense	probably damaging	0.99
R5039:Rimbp3	UTSW	16	17213331	missense	probably damaging	0.99
R5177:Rimbp3	UTSW	16	17209917	missense	possibly damaging	0.85
R5311:Rimbp3	UTSW	16	17210844	missense	probably benign	0.00
R6063:Rimbp3	UTSW	16	17210917	missense	probably damaging	1.00
R6092:Rimbp3	UTSW	16	17212270	missense	probably damaging	1.00
R6126:Rimbp3	UTSW	16	17212276	missense	probably benign	0.25
R6288:Rimbp3	UTSW	16	17212908	missense	probably benign	0.22
R6446:Rimbp3	UTSW	16	17212929	missense	probably benign	0.00
R6773:Rimbp3	UTSW	16	17209015	missense	probably damaging	1.00
R7017:Rimbp3	UTSW	16	17209746	missense	probably benign	0.04
R7043:Rimbp3	UTSW	16	17211108	missense	probably damaging	1.00
R7048:Rimbp3	UTSW	16	17210326	missense	probably benign	0.20
R7378:Rimbp3	UTSW	16	17211204	missense	probably benign
R7440:Rimbp3	UTSW	16	17213201	missense	possibly damaging	0.78
R7788:Rimbp3	UTSW	16	17212704	missense	probably benign	0.00
R7879:Rimbp3	UTSW	16	17211046	missense	possibly damaging	0.71
R8071:Rimbp3	UTSW	16	17210863	missense	probably benign
R8272:Rimbp3	UTSW	16	17209105	missense	possibly damaging	0.85
R8419:Rimbp3	UTSW	16	17213022	missense	probably damaging	0.97
R8819:Rimbp3	UTSW	16	17210907	missense	probably benign	0.17
R8830:Rimbp3	UTSW	16	17209006	missense	probably damaging	0.98
R8936:Rimbp3	UTSW	16	17213020	missense	probably benign
R8982:Rimbp3	UTSW	16	17209647	missense	probably benign	0.11
R9365:Rimbp3	UTSW	16	17208756	missense	possibly damaging	0.93
Z1176:Rimbp3	UTSW	16	17209474	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCTGGCAGCAATAGATATCCGC -3'
(R):5'- AACAGGGTGTTTCCAGCAG -3'

Sequencing Primer
(F):5'- CAATAGATATCCGCATGTGGTGTACC -3'
(R):5'- GCAACTTCGGTCACCTTGAAG -3'

Posted On

2017-02-28