Incidental Mutation 'R5942:Vmn1r231'
ID 460376
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 044134-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R5942 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21110417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 166 (Y166F)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061278
AA Change: Y166F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: Y166F

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,623,333 (GRCm39) V860M probably benign Het
Accs A T 2: 93,666,392 (GRCm39) L432M probably damaging Het
Actrt3 T A 3: 30,652,813 (GRCm39) N94Y possibly damaging Het
Adamts18 T C 8: 114,504,380 (GRCm39) Q80R probably benign Het
Ccr8 G T 9: 119,923,772 (GRCm39) V296F probably damaging Het
Cep170 T A 1: 176,583,985 (GRCm39) E798V probably damaging Het
Cttnbp2 T A 6: 18,448,439 (GRCm39) E73D probably damaging Het
Cyp2a4 A T 7: 26,010,129 (GRCm39) probably null Het
Dync2h1 A T 9: 7,117,466 (GRCm39) Y41* probably null Het
Enc1 G A 13: 97,382,887 (GRCm39) D466N probably benign Het
Enpp1 C A 10: 24,551,966 (GRCm39) E138* probably null Het
Entrep1 A G 19: 23,963,834 (GRCm39) V245A probably damaging Het
Ezh2 T C 6: 47,554,516 (GRCm39) R27G possibly damaging Het
Fut10 A G 8: 31,691,485 (GRCm39) N110S possibly damaging Het
Glt1d1 A T 5: 127,721,534 (GRCm39) probably null Het
Gm14393 G A 2: 174,903,689 (GRCm39) Q73* probably null Het
Gpr156 C T 16: 37,825,264 (GRCm39) P494S probably benign Het
Has2 T A 15: 56,531,192 (GRCm39) K508* probably null Het
Hc A T 2: 34,918,137 (GRCm39) C715* probably null Het
Hook2 C T 8: 85,721,409 (GRCm39) probably null Het
Klhdc7b A C 15: 89,271,634 (GRCm39) I839L probably benign Het
Kndc1 T C 7: 139,516,792 (GRCm39) L1584P probably damaging Het
Lamp1 T C 8: 13,223,941 (GRCm39) F358L probably damaging Het
Man2a1 A G 17: 64,932,375 (GRCm39) K154R probably benign Het
Mga A G 2: 119,777,440 (GRCm39) I1871V probably benign Het
Mgmt T A 7: 136,723,219 (GRCm39) D96E probably benign Het
Morc2a C A 11: 3,629,936 (GRCm39) T424K probably damaging Het
Myo1g A G 11: 6,464,888 (GRCm39) L462P probably damaging Het
Ncaph C A 2: 126,958,608 (GRCm39) probably null Het
Nlrc3 A T 16: 3,767,293 (GRCm39) D969E probably damaging Het
Nt5c3 A T 6: 56,874,839 (GRCm39) probably null Het
Or4c12b G T 2: 89,646,684 (GRCm39) E5* probably null Het
Or5ac15 A T 16: 58,940,039 (GRCm39) Y131* probably null Het
Or5d41 A C 2: 88,054,916 (GRCm39) I153M probably benign Het
Or8h8 T C 2: 86,753,750 (GRCm39) N42S probably damaging Het
Parp14 C A 16: 35,659,737 (GRCm39) M1628I probably damaging Het
Parp8 G T 13: 117,005,969 (GRCm39) P693Q probably benign Het
Parp9 A G 16: 35,792,259 (GRCm39) D485G possibly damaging Het
Pcdha1 T A 18: 37,063,444 (GRCm39) V36D probably damaging Het
Pcdhb5 C T 18: 37,453,838 (GRCm39) Q73* probably null Het
Pecam1 G T 11: 106,552,809 (GRCm39) probably benign Het
Pex1 A G 5: 3,660,277 (GRCm39) I527V probably benign Het
Phf11 G A 14: 59,497,593 (GRCm39) P13S probably benign Het
Ppp4r4 T A 12: 103,553,706 (GRCm39) V388D possibly damaging Het
Psmc4 C T 7: 27,746,480 (GRCm39) V202I probably damaging Het
Ptx3 T G 3: 66,127,484 (GRCm39) M1R probably null Het
Rimbp3 A G 16: 17,029,752 (GRCm39) T1059A probably benign Het
Rmdn3 G A 2: 118,978,058 (GRCm39) A181V probably damaging Het
Rnase10 A T 14: 51,246,735 (GRCm39) M38L probably benign Het
Sec16b T A 1: 157,358,920 (GRCm39) Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 (GRCm39) T32A probably benign Het
Srcap A G 7: 127,137,180 (GRCm39) D954G probably damaging Het
Tfrc A G 16: 32,445,533 (GRCm39) N618S possibly damaging Het
Tnrc6a A G 7: 122,785,888 (GRCm39) D1028G probably damaging Het
Tns3 A T 11: 8,385,860 (GRCm39) D1379E probably damaging Het
Ttn A T 2: 76,580,505 (GRCm39) C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 (GRCm39) T745A probably benign Het
Wbp1l C A 19: 46,642,869 (GRCm39) T290K probably damaging Het
Wdr25 A G 12: 108,864,392 (GRCm39) N179S probably benign Het
Wdr62 G A 7: 29,942,504 (GRCm39) Q1035* probably null Het
Yif1a C T 19: 5,141,669 (GRCm39) R196C probably damaging Het
Zfp352 A T 4: 90,113,307 (GRCm39) K482N probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGCACCAGAATGTTCTTAGTGG -3'
(R):5'- TTCCAGGCCATCACCATCAG -3'

Sequencing Primer
(F):5'- CATAAGTGCTGTGGATATGTTGAACC -3'
(R):5'- GTCCCAGTGACTCGTGC -3'
Posted On 2017-02-28