Incidental Mutation 'R5942:Man2a1'
ID460378
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R5942 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64625380 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 154 (K154R)
Ref Sequence ENSEMBL: ENSMUSP00000083928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723]
Predicted Effect probably benign
Transcript: ENSMUST00000086723
AA Change: K154R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: K154R

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Enpp1 C A 10: 24,676,068 E138* probably null Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Gpr156 C T 16: 38,004,902 P494S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Ncaph C A 2: 127,116,688 probably null Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1098 T C 2: 86,923,406 N42S probably damaging Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdha1 T A 18: 36,930,391 V36D probably damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 T32A probably benign Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64679831 missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4582:Man2a1 UTSW 17 64752499 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5229:Man2a1 UTSW 17 64710734 missense probably benign 0.00
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5273:Man2a1 UTSW 17 64733785 missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64651227 missense probably damaging 0.99
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6245:Man2a1 UTSW 17 64710826 missense probably damaging 0.97
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
R7354:Man2a1 UTSW 17 64752544 missense probably damaging 1.00
RF007:Man2a1 UTSW 17 64712253 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCTTCCAAGCCTTTGAGTG -3'
(R):5'- TCATGGTGAAGTCTGAGAGGC -3'

Sequencing Primer
(F):5'- GCCTTTGGCCTAAAAAGTTTCCATTG -3'
(R):5'- TGAAGTCTGAGAGGCATGGGC -3'
Posted On2017-02-28