Incidental Mutation 'R5942:Pcdha1'
ID460379
Institutional Source Beutler Lab
Gene Symbol Pcdha1
Ensembl Gene ENSMUSG00000103442
Gene Nameprotocadherin alpha 1
Synonyms
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5942 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36930184-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36930391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 36 (V36D)
Ref Sequence ENSEMBL: ENSMUSP00000142308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000193839]
Predicted Effect probably damaging
Transcript: ENSMUST00000070797
AA Change: V36D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442
AA Change: V36D

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192440
Predicted Effect probably damaging
Transcript: ENSMUST00000193839
AA Change: V36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442
AA Change: V36D

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Enpp1 C A 10: 24,676,068 E138* probably null Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Gpr156 C T 16: 38,004,902 P494S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Ncaph C A 2: 127,116,688 probably null Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1098 T C 2: 86,923,406 N42S probably damaging Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 T32A probably benign Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Pcdha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdha1 APN 18 36932175 missense probably damaging 0.99
R0062:Pcdha1 UTSW 18 37006628 missense probably benign 0.08
R0108:Pcdha1 UTSW 18 36998756 missense probably benign
R0543:Pcdha1 UTSW 18 37185068 missense probably damaging 1.00
R1599:Pcdha1 UTSW 18 37185237 missense probably damaging 1.00
R1717:Pcdha1 UTSW 18 36932184 missense probably benign 0.01
R2301:Pcdha1 UTSW 18 37156183 missense probably damaging 1.00
R3038:Pcdha1 UTSW 18 36931011 missense probably damaging 1.00
R3086:Pcdha1 UTSW 18 36930948 missense possibly damaging 0.95
R3693:Pcdha1 UTSW 18 36932308 missense possibly damaging 0.95
R3783:Pcdha1 UTSW 18 36930802 missense probably damaging 1.00
R3881:Pcdha1 UTSW 18 36931401 missense possibly damaging 0.91
R4012:Pcdha1 UTSW 18 36931136 missense probably benign 0.02
R4540:Pcdha1 UTSW 18 36931627 missense probably damaging 1.00
R4597:Pcdha1 UTSW 18 36931906 missense possibly damaging 0.64
R4678:Pcdha1 UTSW 18 36930912 missense probably benign 0.00
R4998:Pcdha1 UTSW 18 36932416 missense probably damaging 1.00
R5466:Pcdha1 UTSW 18 36932259 missense possibly damaging 0.73
R5518:Pcdha1 UTSW 18 36932362 missense probably benign 0.23
R5673:Pcdha1 UTSW 18 36930673 missense probably damaging 1.00
R5925:Pcdha1 UTSW 18 36930671 missense probably damaging 1.00
R5963:Pcdha1 UTSW 18 36931171 missense probably damaging 0.99
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6107:Pcdha1 UTSW 18 36932301 missense probably benign 0.00
R6329:Pcdha1 UTSW 18 36932248 missense probably damaging 1.00
R6479:Pcdha1 UTSW 18 36931456 missense probably benign 0.28
R6503:Pcdha1 UTSW 18 36931671 missense probably damaging 1.00
R6907:Pcdha1 UTSW 18 36931071 missense probably benign 0.01
R7011:Pcdha1 UTSW 18 36930535 missense probably damaging 1.00
R7030:Pcdha1 UTSW 18 37159273 missense probably damaging 0.97
R7314:Pcdha1 UTSW 18 36931500 missense probably damaging 0.99
R7343:Pcdha1 UTSW 18 36930649 missense probably damaging 1.00
R7699:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7700:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7768:Pcdha1 UTSW 18 36932167 missense probably damaging 1.00
R7780:Pcdha1 UTSW 18 36932458 missense probably benign 0.28
R7800:Pcdha1 UTSW 18 36931373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCTTCATTTCGTCACCAG -3'
(R):5'- GTCGATCCGAGAATTCACAAAC -3'

Sequencing Primer
(F):5'- ATTTCGTCACCAGCCGAG -3'
(R):5'- CAAAATGCCATTCTGCAGATTTACC -3'
Posted On2017-02-28