Incidental Mutation 'R0563:Cdh2'
ID46038
Institutional Source Beutler Lab
Gene Symbol Cdh2
Ensembl Gene ENSMUSG00000024304
Gene Namecadherin 2
SynonymsNcad, N-cadherin
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location16588877-16809246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16629681 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 402 (V402D)
Ref Sequence ENSEMBL: ENSMUSP00000111516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025166] [ENSMUST00000115850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025166
AA Change: V459D

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304
AA Change: V459D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Cadherin_pro 31 123 5.77e-34 SMART
low complexity region 129 141 N/A INTRINSIC
CA 182 265 3.37e-17 SMART
CA 289 380 2.15e-33 SMART
CA 403 496 4.38e-16 SMART
CA 519 603 2.27e-23 SMART
CA 623 708 5.54e-2 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:Cadherin_C 753 903 6.3e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115850
AA Change: V402D

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111516
Gene: ENSMUSG00000024304
AA Change: V402D

DomainStartEndE-ValueType
Cadherin_pro 1 66 3.44e-9 SMART
low complexity region 72 84 N/A INTRINSIC
CA 125 208 3.37e-17 SMART
CA 232 323 2.15e-33 SMART
CA 346 439 4.38e-16 SMART
CA 462 546 2.27e-23 SMART
CA 566 651 5.54e-2 SMART
transmembrane domain 667 689 N/A INTRINSIC
Pfam:Cadherin_C 690 847 2.5e-57 PFAM
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Cdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Cdh2 APN 18 16627636 missense possibly damaging 0.69
IGL01560:Cdh2 APN 18 16650438 missense probably benign 0.01
IGL02028:Cdh2 APN 18 16650420 missense probably benign 0.07
IGL02227:Cdh2 APN 18 16629586 missense probably benign 0.01
IGL02229:Cdh2 APN 18 16624753 missense probably benign
IGL02617:Cdh2 APN 18 16627604 missense probably damaging 1.00
IGL02685:Cdh2 APN 18 16646500 missense probably damaging 1.00
IGL02724:Cdh2 APN 18 16629480 missense probably benign 0.29
R0111:Cdh2 UTSW 18 16774509 missense probably benign
R0173:Cdh2 UTSW 18 16650257 splice site probably benign
R0197:Cdh2 UTSW 18 16629576 missense probably benign
R0883:Cdh2 UTSW 18 16629576 missense probably benign
R1083:Cdh2 UTSW 18 16643959 missense possibly damaging 0.61
R1270:Cdh2 UTSW 18 16627557 splice site probably benign
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1510:Cdh2 UTSW 18 16648594 missense probably benign
R1875:Cdh2 UTSW 18 16624877 missense probably benign
R2122:Cdh2 UTSW 18 16774543 missense probably benign 0.01
R2194:Cdh2 UTSW 18 16640448 missense probably damaging 1.00
R2254:Cdh2 UTSW 18 16643928 critical splice donor site probably null
R4471:Cdh2 UTSW 18 16774476 intron probably null
R4501:Cdh2 UTSW 18 16629585 missense possibly damaging 0.53
R4620:Cdh2 UTSW 18 16648608 missense probably benign
R4832:Cdh2 UTSW 18 16627697 missense probably benign 0.01
R4944:Cdh2 UTSW 18 16650409 missense probably damaging 0.99
R4958:Cdh2 UTSW 18 16627565 splice site probably null
R5160:Cdh2 UTSW 18 16629587 missense probably damaging 0.99
R5190:Cdh2 UTSW 18 16650315 missense possibly damaging 0.54
R5446:Cdh2 UTSW 18 16646627 missense probably damaging 1.00
R5552:Cdh2 UTSW 18 16640463 missense possibly damaging 0.88
R5699:Cdh2 UTSW 18 16646522 nonsense probably null
R5912:Cdh2 UTSW 18 16640450 missense possibly damaging 0.79
R5949:Cdh2 UTSW 18 16601630 missense probably damaging 1.00
R6313:Cdh2 UTSW 18 16774522 missense probably benign 0.00
R6633:Cdh2 UTSW 18 16640548 missense probably benign 0.00
R7822:Cdh2 UTSW 18 16624284 missense probably benign 0.24
R8022:Cdh2 UTSW 18 16590301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCACACAGGGCATAGAACAGAATC -3'
(R):5'- CTGTCAGGGTGAGTTTCAATGAGACC -3'

Sequencing Primer
(F):5'- TAGGACACCTCAATAGTGCTTC -3'
(R):5'- GAGTTTCAATGAGACCATCCTGC -3'
Posted On2013-06-11