Incidental Mutation 'R5943:Clcn1'
ID460412
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5943 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42292966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 241 (I241N)
Ref Sequence ENSEMBL: ENSMUSP00000131354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: I241N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: I241N

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: I211N
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: I211N

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164091
AA Change: I241N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862
AA Change: I241N

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165780
AA Change: I211N
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862
AA Change: I211N

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168660
AA Change: I208N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: I208N

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169024
AA Change: I211N
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: I211N

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170028
AA Change: I211N
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: I211N

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42291334 nonsense probably null
R7663:Clcn1 UTSW 6 42310063 missense possibly damaging 0.79
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTAGGCTGTGGCATTG -3'
(R):5'- TAAGATTCCGCCTTCAGCC -3'

Sequencing Primer
(F):5'- TGATAGCACACTGATTTTTCATCTC -3'
(R):5'- ATTCCGCCTTCAGCCCCAAG -3'
Posted On2017-02-28