Incidental Mutation 'R0563:Gna14'
ID46042
Institutional Source Beutler Lab
Gene Symbol Gna14
Ensembl Gene ENSMUSG00000024697
Gene Nameguanine nucleotide binding protein, alpha 14
SynonymsG alpha 14
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16435667-16610818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16608119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 287 (Y287C)
Ref Sequence ENSEMBL: ENSMUSP00000025602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025602]
Predicted Effect probably benign
Transcript: ENSMUST00000025602
AA Change: Y287C

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025602
Gene: ENSMUSG00000024697
AA Change: Y287C

DomainStartEndE-ValueType
G_alpha 15 354 9.68e-201 SMART
Meta Mutation Damage Score 0.1658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding, or G protein family. G proteins are heterotrimers consisting of alpha, beta and gamma subunits. The encoded protein is a member of the alpha family of G proteins, more specifically the alpha q subfamily of G proteins. The encoded protein may play a role in pertussis-toxin resistant activation of phospholipase C-beta and its downstream effectors.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Gna14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Gna14 APN 19 16533726 missense probably damaging 1.00
IGL03331:Gna14 APN 19 16609468 missense probably damaging 1.00
R1479:Gna14 UTSW 19 16533769 missense possibly damaging 0.50
R2058:Gna14 UTSW 19 16608141 splice site probably benign
R3016:Gna14 UTSW 19 16603382 missense probably benign 0.00
R4607:Gna14 UTSW 19 16533711 critical splice acceptor site probably null
R4703:Gna14 UTSW 19 16598980 missense possibly damaging 0.95
R4948:Gna14 UTSW 19 16603292 missense probably benign 0.00
R5027:Gna14 UTSW 19 16603272 missense probably benign 0.03
R5512:Gna14 UTSW 19 16608128 missense probably benign 0.07
R5629:Gna14 UTSW 19 16436733 missense possibly damaging 0.71
R5895:Gna14 UTSW 19 16603328 missense possibly damaging 0.92
R6108:Gna14 UTSW 19 16603343 missense probably damaging 0.98
R7037:Gna14 UTSW 19 16533764 missense
R7310:Gna14 UTSW 19 16533749 missense
R7403:Gna14 UTSW 19 16599081 missense
R8155:Gna14 UTSW 19 16598974 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGACACACTTTCCAAGCCTTGCC -3'
(R):5'- AGACAACTCTGCTCCGAAGAGTCAC -3'

Sequencing Primer
(F):5'- AAGCCTTGCCTTTCTTCTTGG -3'
(R):5'- TTCAGGCCCTTGCATGG -3'
Posted On2013-06-11