Incidental Mutation 'R5944:Fap'
ID 460464
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Name fibroblast activation protein
Synonyms
MMRRC Submission 044136-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5944 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 62500943-62574075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62542261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 258 (Y258C)
Ref Sequence ENSEMBL: ENSMUSP00000000402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000174234] [ENSMUST00000174448]
AlphaFold P97321
Predicted Effect probably damaging
Transcript: ENSMUST00000000402
AA Change: Y258C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: Y258C

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102732
AA Change: Y291C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: Y291C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172676
Predicted Effect probably damaging
Transcript: ENSMUST00000174234
AA Change: Y266C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: Y266C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174448
AA Change: Y286C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: Y286C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Meta Mutation Damage Score 0.3153 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62524201 missense possibly damaging 0.82
IGL01420:Fap APN 2 62504502 splice site probably benign
IGL01485:Fap APN 2 62544311 missense possibly damaging 0.80
IGL01987:Fap APN 2 62528676 missense probably damaging 1.00
IGL02198:Fap APN 2 62554798 missense probably benign
IGL02355:Fap APN 2 62573498 missense probably benign 0.02
IGL02362:Fap APN 2 62573498 missense probably benign 0.02
IGL03227:Fap APN 2 62530763 critical splice acceptor site probably null
IGL03266:Fap APN 2 62537022 missense probably benign
IGL03369:Fap APN 2 62503355 splice site probably benign
IGL03406:Fap APN 2 62542122 splice site probably benign
mnemosyne UTSW 2 62528714 missense probably damaging 1.00
R1467_Fap_571 UTSW 2 62517620 missense probably benign 0.18
R4812_Fap_496 UTSW 2 62519021 missense probably damaging 1.00
R5661_fap_070 UTSW 2 62536963 intron probably benign
ANU74:Fap UTSW 2 62547769 missense probably damaging 1.00
R0254:Fap UTSW 2 62503402 missense probably damaging 1.00
R0842:Fap UTSW 2 62537001 missense probably damaging 1.00
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1591:Fap UTSW 2 62553857 missense probably damaging 0.99
R1671:Fap UTSW 2 62553835 missense possibly damaging 0.46
R1674:Fap UTSW 2 62519005 missense probably benign
R1795:Fap UTSW 2 62548589 missense probably damaging 1.00
R1869:Fap UTSW 2 62528727 missense probably damaging 1.00
R2032:Fap UTSW 2 62542237 missense probably benign 0.43
R2136:Fap UTSW 2 62524207 missense possibly damaging 0.94
R3546:Fap UTSW 2 62519011 missense probably damaging 1.00
R3547:Fap UTSW 2 62519011 missense probably damaging 1.00
R3771:Fap UTSW 2 62533010 missense probably damaging 1.00
R3801:Fap UTSW 2 62546650 missense probably benign 0.04
R3910:Fap UTSW 2 62556104 missense probably damaging 1.00
R4306:Fap UTSW 2 62530707 critical splice donor site probably null
R4323:Fap UTSW 2 62503372 missense probably damaging 0.97
R4517:Fap UTSW 2 62530715 missense probably benign 0.01
R4793:Fap UTSW 2 62544369 missense probably damaging 1.00
R4812:Fap UTSW 2 62519021 missense probably damaging 1.00
R4843:Fap UTSW 2 62544374 missense probably damaging 1.00
R5281:Fap UTSW 2 62532961 critical splice donor site probably null
R5661:Fap UTSW 2 62536963 intron probably benign
R5696:Fap UTSW 2 62502459 missense probably damaging 1.00
R5750:Fap UTSW 2 62528714 missense probably damaging 1.00
R5898:Fap UTSW 2 62573503 missense probably benign
R5907:Fap UTSW 2 62544356 missense probably damaging 1.00
R5991:Fap UTSW 2 62518521 missense probably damaging 1.00
R6110:Fap UTSW 2 62554770 missense possibly damaging 0.91
R6270:Fap UTSW 2 62547788 missense probably damaging 0.98
R6505:Fap UTSW 2 62546603 nonsense probably null
R6631:Fap UTSW 2 62503381 missense probably damaging 1.00
R6896:Fap UTSW 2 62504600 nonsense probably null
R7138:Fap UTSW 2 62542178 missense probably benign 0.10
R7806:Fap UTSW 2 62503414 missense probably damaging 1.00
R8000:Fap UTSW 2 62502798 critical splice donor site probably null
R8115:Fap UTSW 2 62519041 missense probably benign 0.07
R8737:Fap UTSW 2 62512433 missense probably benign 0.00
R8899:Fap UTSW 2 62518473 missense probably damaging 1.00
R8924:Fap UTSW 2 62547821 missense probably benign
R8972:Fap UTSW 2 62548583 missense probably benign 0.02
R8998:Fap UTSW 2 62537024 missense probably benign 0.12
R8999:Fap UTSW 2 62537024 missense probably benign 0.12
R9418:Fap UTSW 2 62554837 nonsense probably null
R9521:Fap UTSW 2 62542156 missense probably benign
R9686:Fap UTSW 2 62573513 missense possibly damaging 0.86
X0017:Fap UTSW 2 62556180 missense probably benign 0.04
X0026:Fap UTSW 2 62512390 missense probably damaging 1.00
Z1176:Fap UTSW 2 62528774 missense possibly damaging 0.87
Z1177:Fap UTSW 2 62502446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGCGGTTGAATGCACC -3'
(R):5'- AGATAGATAGTGTTGCCCTTACATC -3'

Sequencing Primer
(F):5'- GGTTGAATGCACCAAATCCTG -3'
(R):5'- AACTTCTTACTTATTTTAGCCCGCAG -3'
Posted On 2017-02-28