Mutagenetix > Incidental Mutation

Incidental Mutation 'R0564:Col6a3'

46047

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

038755-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0564 (G1)

Quality Score

191

Status

Validated

Chromosome

Chromosomal Location

90765923-90843971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 90807734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 731 (V731G)

Ref Sequence

ENSEMBL: ENSMUSP00000140858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000056925
AA Change: V1338G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: V1338G

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097653
AA Change: V731G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: V731G

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130846
AA Change: V1338G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: V1338G

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
Pfam:VWA	1636	1703	1.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136916

Predicted Effect

probably damaging
Transcript: ENSMUST00000188587
AA Change: V731G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: V731G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Meta Mutation Damage Score

0.7841

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	A	G	10: 80,344,847	V127A	probably damaging	Het
Alox12	T	A	11: 70,252,836	D202V	probably damaging	Het
Ankib1	A	G	5: 3,729,655	Y405H	probably damaging	Het
Apbb2	A	T	5: 66,452,250	M18K	probably damaging	Het
Atad2	C	A	15: 58,125,833		probably benign	Het
BC117090	A	T	16: 36,322,984	Y34*	probably null	Het
Birc6	T	A	17: 74,625,243		probably benign	Het
Ccdc126	T	C	6: 49,334,142	M28T	possibly damaging	Het
Cdc16	A	T	8: 13,781,618	D617V	probably damaging	Het
Cep135	G	A	5: 76,615,710	E516K	probably damaging	Het
Cep135	G	T	5: 76,638,949	M1081I	probably benign	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
D230025D16Rik	T	A	8: 105,239,971		probably benign	Het
Dip2b	C	A	15: 100,162,719	Y258*	probably null	Het
Dnah17	A	G	11: 118,082,981	V1900A	probably damaging	Het
Dpysl2	A	T	14: 66,805,446		probably benign	Het
Dync2h1	A	T	9: 7,139,432	L1401Q	probably damaging	Het
Esf1	A	T	2: 140,158,586	Y427N	possibly damaging	Het
Fbln1	T	A	15: 85,227,107	V154D	probably benign	Het
Frem2	A	G	3: 53,656,109	F326L	probably damaging	Het
Gm4922	T	A	10: 18,784,065	N303I	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Iigp1	G	A	18: 60,390,451	V214M	probably damaging	Het
Luzp2	A	G	7: 54,835,962	K2E	probably damaging	Het
Mcc	A	G	18: 44,468,507	L410P	probably damaging	Het
Mfn2	A	G	4: 147,883,255	F452S	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Micu2	A	G	14: 57,919,374	F335L	possibly damaging	Het
Mpp3	T	G	11: 102,005,347	K450T	possibly damaging	Het
Mtmr4	T	A	11: 87,598,888	V79E	probably damaging	Het
Nlrp4b	A	G	7: 10,714,658	I263V	probably benign	Het
Olfr551	T	C	7: 102,588,531	I71V	probably benign	Het
Olfr809	T	G	10: 129,776,136	V74G	probably damaging	Het
Pdk1	G	A	2: 71,880,039	W113*	probably null	Het
Phxr4	A	T	9: 13,431,697		probably benign	Het
Rad51ap2	T	A	12: 11,457,896	H606Q	probably benign	Het
Ralgapa1	A	T	12: 55,782,885	I187K	possibly damaging	Het
Rps27	A	G	3: 90,212,923		probably benign	Het
Sema3e	T	A	5: 14,236,085		probably null	Het
Sh2d3c	G	A	2: 32,753,052	C749Y	probably damaging	Het
Siah2	T	C	3: 58,676,235	D210G	probably benign	Het
Smap2	G	A	4: 120,976,977	P155S	probably benign	Het
Snrk	C	T	9: 122,166,544	T463M	possibly damaging	Het
Tm9sf3	A	G	19: 41,245,525		probably benign	Het
Tmem132d	C	T	5: 127,784,778	E760K	probably damaging	Het
Tmem184c	A	T	8: 77,606,160		probably null	Het
Tmem235	A	T	11: 117,860,848	I33F	possibly damaging	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Top1	G	A	2: 160,714,265	R548Q	probably damaging	Het
Trio	T	C	15: 27,805,822	N527D	probably damaging	Het
Upf3a	A	G	8: 13,795,656	K252E	probably benign	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90828255	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90782026	missense	unknown
IGL00541:Col6a3	APN	1	90802142	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90802332	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90803933	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90807510	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90802292	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90802514	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90779162	missense	unknown
IGL01827:Col6a3	APN	1	90802319	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90796571	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90773048	missense	unknown
IGL01900:Col6a3	APN	1	90795010	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90802236	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90782136	splice site	probably benign
IGL02115:Col6a3	APN	1	90807651	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90781760	missense	unknown
IGL02313:Col6a3	APN	1	90811606	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90779197	missense	unknown
IGL02821:Col6a3	APN	1	90803878	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90796559	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90811520	nonsense	probably null
IGL03129:Col6a3	APN	1	90821862	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90803893	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90827866	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90810176	missense	probably damaging	1.00
bailey	UTSW	1	90767606	critical splice acceptor site	probably benign
barnum	UTSW	1	90779152	missense	unknown
Boneless	UTSW	1	90779059	missense	unknown
Noodloid	UTSW	1	90779289	missense	unknown
randolf	UTSW	1	90787951	missense	unknown
stringy	UTSW	1	90803678	nonsense	probably null
wonder	UTSW	1	90791923	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90802292	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90810248	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90778794	missense	unknown
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90798161	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90813551	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90798173	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90807704	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90828049	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90788216	missense	unknown
R0512:Col6a3	UTSW	1	90821798	intron	probably benign
R0635:Col6a3	UTSW	1	90808086	splice site	probably null
R0667:Col6a3	UTSW	1	90828101	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90778981	missense	unknown
R0736:Col6a3	UTSW	1	90804089	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90828298	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90802653	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90794325	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90822014	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90781855	missense	unknown
R1225:Col6a3	UTSW	1	90811516	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90768347	missense	unknown
R1387:Col6a3	UTSW	1	90822416	intron	probably benign
R1437:Col6a3	UTSW	1	90801376	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90781855	missense	unknown
R1677:Col6a3	UTSW	1	90821861	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90773502	missense	unknown
R1711:Col6a3	UTSW	1	90830213	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90796574	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90779059	missense	unknown
R1738:Col6a3	UTSW	1	90816361	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90813794	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90827949	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90830214	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90811699	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90822359	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90804175	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90782011	missense	unknown
R2121:Col6a3	UTSW	1	90810365	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90803745	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90813358	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90803713	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90775599	missense	unknown
R3052:Col6a3	UTSW	1	90802130	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90780081	missense	unknown
R4007:Col6a3	UTSW	1	90802569	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90821883	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90801383	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90786639	missense	unknown
R4297:Col6a3	UTSW	1	90811378	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90822014	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90781904	missense	unknown
R4683:Col6a3	UTSW	1	90773457	missense	unknown
R4788:Col6a3	UTSW	1	90772950	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90779289	missense	unknown
R4899:Col6a3	UTSW	1	90802427	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90801442	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90807524	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90804218	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90778843	missense	unknown
R5057:Col6a3	UTSW	1	90816130	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90779352	missense	unknown
R5105:Col6a3	UTSW	1	90798140	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90768345	missense	unknown
R5166:Col6a3	UTSW	1	90810608	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90773639	nonsense	probably null
R5196:Col6a3	UTSW	1	90816538	splice site	probably null
R5230:Col6a3	UTSW	1	90789054	missense	unknown
R5268:Col6a3	UTSW	1	90785243	missense	unknown
R5381:Col6a3	UTSW	1	90775612	missense	unknown
R5392:Col6a3	UTSW	1	90801295	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90782039	nonsense	probably null
R5571:Col6a3	UTSW	1	90788216	missense	unknown
R5665:Col6a3	UTSW	1	90827880	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90802199	splice site	probably null
R5914:Col6a3	UTSW	1	90776200	missense	unknown
R5955:Col6a3	UTSW	1	90811441	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90821849	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90768383	missense	unknown
R6010:Col6a3	UTSW	1	90773497	missense	unknown
R6025:Col6a3	UTSW	1	90828102	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90813753	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90773665	missense	unknown
R6181:Col6a3	UTSW	1	90816374	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90822341	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90822233	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90810563	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90781812	missense	unknown
R6484:Col6a3	UTSW	1	90791923	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6724:Col6a3	UTSW	1	90779152	missense	unknown
R6746:Col6a3	UTSW	1	90779045	missense	unknown
R6797:Col6a3	UTSW	1	90804088	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90795009	splice site	probably null
R6903:Col6a3	UTSW	1	90794207	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90816002	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90807470	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90828037	nonsense	probably null
R7182:Col6a3	UTSW	1	90803678	nonsense	probably null
R7294:Col6a3	UTSW	1	90828283	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90827986	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90822291	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90828133	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90775741	missense	unknown
R7575:Col6a3	UTSW	1	90810599	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90781745	missense	unknown
R7679:Col6a3	UTSW	1	90811751	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90796546	nonsense	probably null
R7855:Col6a3	UTSW	1	90810621	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90781855	missense	unknown
R8003:Col6a3	UTSW	1	90775733	missense	unknown
R8007:Col6a3	UTSW	1	90777457	missense	unknown
R8098:Col6a3	UTSW	1	90803661	missense	probably benign
R8312:Col6a3	UTSW	1	90813690	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90802213	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90800025	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90768449	missense	unknown
R8857:Col6a3	UTSW	1	90775763	missense	unknown
R8867:Col6a3	UTSW	1	90787951	missense	unknown
R8887:Col6a3	UTSW	1	90828226	missense	probably benign
R9011:Col6a3	UTSW	1	90782335	splice site	probably benign
R9049:Col6a3	UTSW	1	90779344	missense	unknown
R9142:Col6a3	UTSW	1	90778844	missense	unknown
R9155:Col6a3	UTSW	1	90810579	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90779298	missense	unknown
R9258:Col6a3	UTSW	1	90772981	missense	unknown
R9274:Col6a3	UTSW	1	90779298	missense	unknown
R9276:Col6a3	UTSW	1	90807681	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90811257	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90781801	missense	unknown
R9377:Col6a3	UTSW	1	90816239	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90803863	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90816433	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90779346	missense	unknown
R9441:Col6a3	UTSW	1	90777527	nonsense	probably null
R9477:Col6a3	UTSW	1	90778899	missense	unknown
R9498:Col6a3	UTSW	1	90785928	nonsense	probably null
R9528:Col6a3	UTSW	1	90804067	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90803775	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90811262	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90810560	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90803637	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90803905	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90811529	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90811728	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TATGGGGAGATGTGCTCAGCCTAC -3'
(R):5'- TGAATGCCCACTTCAGCAAGGATG -3'

Sequencing Primer
(F):5'- cccacccccacccctac -3'
(R):5'- CACTTCAGCAAGGATGAAGTACAG -3'

Posted On

2013-06-11