Mutagenetix > Incidental Mutation

Incidental Mutation 'R5944:Cyfip1'

460478

Institutional Source

Beutler Lab

Gene Symbol

Cyfip1

Ensembl Gene

ENSMUSG00000030447

Gene Name

cytoplasmic FMR1 interacting protein 1

Synonyms

l(7)1Rl, pl-1, P140SRA-1, l7Rl1, Sra-1, Shyc, E030028J09Rik

MMRRC Submission

044136-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5944 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55841745-55932602 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55872130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 61 (E61K)

Ref Sequence

ENSEMBL: ENSMUSP00000082353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000085255] [ENSMUST00000163845] [ENSMUST00000173783] [ENSMUST00000206862]

AlphaFold

Q7TMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000032629
AA Change: E61K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447
AA Change: E61K

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:DUF1394	59	302	5.7e-11	PFAM
Pfam:FragX_IP	389	1222	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085255
AA Change: E61K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447
AA Change: E61K

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:FragX_IP	385	1222	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163845
AA Change: E61K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447
AA Change: E61K

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:FragX_IP	385	1224	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168271

SMART Domains

Protein: ENSMUSP00000131596
Gene: ENSMUSG00000030447

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:DUF1394	57	267	1.8e-9	PFAM
low complexity region	390	403	N/A	INTRINSIC
low complexity region	411	428	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173497

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173783
AA Change: E61K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134509
Gene: ENSMUSG00000030447
AA Change: E61K

Domain	Start	End	E-Value	Type
PDB:4N78\|A	1	230	1e-142	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000206862

Meta Mutation Damage Score

0.8369

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

86% (51/59)

MGI Phenotype

PHENOTYPE: Mutations at this locus result in embryonic lethality before the turning stage in homozygotes. Heterozygotes exhibit abnormal synaptic transmission. Parental origin of the mutant allele in heterozygotes has an effect on long term depression, cued fear conditioning, anxiety, and activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	T	5: 114,245,980	R2190L	probably damaging	Het
Ankrd17	C	T	5: 90,285,843	R689H	probably damaging	Het
Apol7b	A	T	15: 77,423,767	V176E	probably damaging	Het
Arsg	T	C	11: 109,535,311	F319S	probably damaging	Het
Bcar3	T	A	3: 122,523,283	D634E	probably benign	Het
Bend7	T	C	2: 4,744,356	W95R	probably damaging	Het
Cenpj	A	G	14: 56,553,658		probably null	Het
Clasrp	A	T	7: 19,594,506	Y116N	probably damaging	Het
Cldn17	T	C	16: 88,506,709	E44G	probably damaging	Het
Dcaf13	A	C	15: 39,146,677	M419L	probably benign	Het
Eml4	A	G	17: 83,446,043	D269G	possibly damaging	Het
Fap	T	C	2: 62,542,261	Y258C	probably damaging	Het
Fdxr	T	A	11: 115,269,846	T288S	probably benign	Het
Frs3	T	C	17: 47,692,308		probably benign	Het
Gm5581	T	A	6: 131,168,400		noncoding transcript	Het
Gm7964	A	G	7: 83,756,535	D187G	probably benign	Het
Gpc5	T	C	14: 115,369,838	V284A	probably benign	Het
Hspa9	T	C	18: 34,949,023	T177A	possibly damaging	Het
Ifi202b	T	A	1: 173,963,799	M438L	probably benign	Het
Ighv1-3	T	C	12: 114,481,619		probably benign	Het
Krt36	G	T	11: 100,105,313	A95E	probably benign	Het
Krt9	C	T	11: 100,188,439	S709N	unknown	Het
Lmntd1	A	T	6: 145,427,316	S164T	probably damaging	Het
Maats1	G	T	16: 38,328,310	T252N	probably damaging	Het
Olfr1442	C	T	19: 12,674,919	T238I	probably damaging	Het
Olfr295	T	A	7: 86,585,278	M1K	probably null	Het
Olfr503	G	A	7: 108,545,277	A249T	possibly damaging	Het
Olfr57	A	T	10: 79,035,389	M198L	probably benign	Het
Olfr694	A	T	7: 106,689,646	C28*	probably null	Het
Papola	T	A	12: 105,812,385	F341I	possibly damaging	Het
Phf3	A	G	1: 30,820,704	L914P	probably damaging	Het
Sec24d	T	C	3: 123,293,581	V132A	probably benign	Het
Serpini1	G	A	3: 75,640,299	D373N	probably damaging	Het
Sigirr	T	C	7: 141,091,387	Y394C	probably damaging	Het
Slc29a4	G	A	5: 142,718,818	E372K	probably damaging	Het
Slc7a4	C	T	16: 17,574,356	V405I	possibly damaging	Het
Spatc1	T	C	15: 76,283,938	L199P	probably damaging	Het
Srgap3	T	C	6: 112,795,814	M149V	possibly damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stat3	C	T	11: 100,895,105	A449T	probably damaging	Het
Stat4	A	G	1: 52,074,739	N203D	probably damaging	Het
Tanc1	T	C	2: 59,837,220		probably null	Het
Trav3-1	T	C	14: 52,580,992	I41T	probably benign	Het
Usp34	T	A	11: 23,363,089	D525E	probably damaging	Het
Vars	T	C	17: 35,013,644	V848A	probably damaging	Het
Vmn2r101	A	T	17: 19,589,507	D185V	probably benign	Het
Wiz	A	G	17: 32,357,697	S628P	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Cyfip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Cyfip1	APN	7	55904210	missense	probably damaging	1.00
IGL01351:Cyfip1	APN	7	55898243	nonsense	probably null
IGL01662:Cyfip1	APN	7	55896739	missense	probably damaging	1.00
IGL02034:Cyfip1	APN	7	55898353	missense	probably damaging	0.99
IGL02039:Cyfip1	APN	7	55875021	missense	possibly damaging	0.90
IGL02063:Cyfip1	APN	7	55926348	missense	probably damaging	1.00
IGL02429:Cyfip1	APN	7	55871982	splice site	probably benign
IGL03256:Cyfip1	APN	7	55907434	missense	possibly damaging	0.67
R0455:Cyfip1	UTSW	7	55892054	missense	probably benign	0.18
R0546:Cyfip1	UTSW	7	55922816	nonsense	probably null
R0671:Cyfip1	UTSW	7	55923962	splice site	probably null
R0732:Cyfip1	UTSW	7	55886781	missense	probably damaging	1.00
R0843:Cyfip1	UTSW	7	55922820	missense	probably benign	0.24
R1666:Cyfip1	UTSW	7	55871898	missense	probably damaging	0.99
R1789:Cyfip1	UTSW	7	55926395	missense	probably damaging	1.00
R1817:Cyfip1	UTSW	7	55873448	missense	possibly damaging	0.51
R1929:Cyfip1	UTSW	7	55899957	missense	probably null	1.00
R2271:Cyfip1	UTSW	7	55899957	missense	probably null	1.00
R2272:Cyfip1	UTSW	7	55899957	missense	probably null	1.00
R2328:Cyfip1	UTSW	7	55894991	missense	possibly damaging	0.87
R2518:Cyfip1	UTSW	7	55928284	missense	probably damaging	1.00
R2963:Cyfip1	UTSW	7	55895035	missense	probably damaging	0.99
R4271:Cyfip1	UTSW	7	55879101	missense	probably benign	0.02
R4435:Cyfip1	UTSW	7	55900041	missense	probably damaging	0.99
R4640:Cyfip1	UTSW	7	55913451	missense	possibly damaging	0.92
R4676:Cyfip1	UTSW	7	55875013	missense	probably damaging	0.99
R4887:Cyfip1	UTSW	7	55872068	missense	probably damaging	1.00
R5085:Cyfip1	UTSW	7	55898335	missense	probably benign	0.33
R5238:Cyfip1	UTSW	7	55892031	missense	probably benign
R5244:Cyfip1	UTSW	7	55925199	missense	probably damaging	1.00
R5288:Cyfip1	UTSW	7	55925135	missense	possibly damaging	0.60
R5294:Cyfip1	UTSW	7	55873483	missense	possibly damaging	0.88
R5552:Cyfip1	UTSW	7	55872107	missense	possibly damaging	0.94
R5558:Cyfip1	UTSW	7	55892001	missense	possibly damaging	0.71
R5667:Cyfip1	UTSW	7	55873730	missense	probably benign	0.19
R5819:Cyfip1	UTSW	7	55879151	missense	probably damaging	1.00
R5859:Cyfip1	UTSW	7	55925181	missense	probably damaging	1.00
R5867:Cyfip1	UTSW	7	55926313	missense	probably damaging	1.00
R5868:Cyfip1	UTSW	7	55926313	missense	probably damaging	1.00
R6124:Cyfip1	UTSW	7	55897943	missense	probably benign	0.12
R6131:Cyfip1	UTSW	7	55873480	missense	possibly damaging	0.79
R6219:Cyfip1	UTSW	7	55908441	missense	possibly damaging	0.52
R6243:Cyfip1	UTSW	7	55900529	missense	probably damaging	1.00
R6669:Cyfip1	UTSW	7	55900061	missense	probably damaging	0.99
R6869:Cyfip1	UTSW	7	55907365	missense	possibly damaging	0.73
R7014:Cyfip1	UTSW	7	55919493	missense	probably benign	0.34
R7224:Cyfip1	UTSW	7	55928189	frame shift	probably null
R7225:Cyfip1	UTSW	7	55928189	frame shift	probably null
R7305:Cyfip1	UTSW	7	55928189	frame shift	probably null
R7336:Cyfip1	UTSW	7	55926400	missense	possibly damaging	0.96
R7429:Cyfip1	UTSW	7	55900593	missense	probably damaging	1.00
R7430:Cyfip1	UTSW	7	55900593	missense	probably damaging	1.00
R7469:Cyfip1	UTSW	7	55877720	missense	possibly damaging	0.91
R7568:Cyfip1	UTSW	7	55872249	splice site	probably null
R7830:Cyfip1	UTSW	7	55873462	missense	probably damaging	1.00
R7839:Cyfip1	UTSW	7	55886735	missense	probably damaging	0.98
R7859:Cyfip1	UTSW	7	55900026	missense	probably damaging	1.00
R7965:Cyfip1	UTSW	7	55896775	missense	possibly damaging	0.78
R8176:Cyfip1	UTSW	7	55924427	missense	probably benign	0.12
R8386:Cyfip1	UTSW	7	55877740	missense	probably damaging	1.00
R8388:Cyfip1	UTSW	7	55872125	missense	probably damaging	1.00
R8444:Cyfip1	UTSW	7	55872154	missense	possibly damaging	0.64
R8845:Cyfip1	UTSW	7	55930086	missense	probably benign	0.00
R8986:Cyfip1	UTSW	7	55908392	missense	probably damaging	1.00
R9197:Cyfip1	UTSW	7	55904474	missense	probably null	0.31
R9214:Cyfip1	UTSW	7	55873525	critical splice donor site	probably null
R9228:Cyfip1	UTSW	7	55900010	missense	probably damaging	1.00
R9269:Cyfip1	UTSW	7	55907431	nonsense	probably null
R9336:Cyfip1	UTSW	7	55904441	missense	probably benign	0.01
R9599:Cyfip1	UTSW	7	55913529	critical splice donor site	probably null
R9622:Cyfip1	UTSW	7	55879105	missense	possibly damaging	0.87
X0018:Cyfip1	UTSW	7	55900025	missense	probably damaging	0.98
X0028:Cyfip1	UTSW	7	55907430	missense	probably damaging	1.00
Z1088:Cyfip1	UTSW	7	55875052	missense	probably damaging	0.99
Z1177:Cyfip1	UTSW	7	55898320	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CTCGCTGCTCTATCAGGTAG -3'
(R):5'- GCTGGCAAAGAATTTCTCTGGG -3'

Sequencing Primer
(F):5'- CGCTGCTCTATCAGGTAGGTCTTG -3'
(R):5'- GGTGTCCTGGAACTCACTCTATAAG -3'

Posted On

2017-02-28