Incidental Mutation 'R0564:Sh2d3c'
ID 46048
Institutional Source Beutler Lab
Gene Symbol Sh2d3c
Ensembl Gene ENSMUSG00000059013
Gene Name SH2 domain containing 3C
Synonyms Cas/HEF1-associated signal transducer, Nsp3, Shep1, Chat, SH2-containing Eph receptor-binding protein 1
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 32611072-32645008 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32643064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 749 (C749Y)
Ref Sequence ENSEMBL: ENSMUSP00000073866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009707] [ENSMUST00000074248] [ENSMUST00000091059] [ENSMUST00000113242] [ENSMUST00000156617] [ENSMUST00000175763] [ENSMUST00000177382]
AlphaFold Q9QZS8
Predicted Effect probably benign
Transcript: ENSMUST00000009707
SMART Domains Protein: ENSMUSP00000009707
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 160 1.2e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074248
AA Change: C749Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073866
Gene: ENSMUSG00000059013
AA Change: C749Y

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
low complexity region 22 43 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
low complexity region 190 207 N/A INTRINSIC
SH2 213 301 7.8e-21 SMART
low complexity region 333 348 N/A INTRINSIC
low complexity region 400 415 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
RasGEF 576 849 8.18e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113242
AA Change: C597Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108868
Gene: ENSMUSG00000059013
AA Change: C597Y

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
SH2 61 149 7.8e-21 SMART
low complexity region 181 196 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
low complexity region 270 284 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
RasGEF 424 697 8.18e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123624
Predicted Effect probably benign
Transcript: ENSMUST00000140999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149720
Predicted Effect probably benign
Transcript: ENSMUST00000156617
SMART Domains Protein: ENSMUSP00000122251
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175763
SMART Domains Protein: ENSMUSP00000135701
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177382
SMART Domains Protein: ENSMUSP00000134968
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 101 1.4e-25 PFAM
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with absence of gastric milk. Surviving mice exhibit abnormal olfactory bulb innervation, fewer gonadotrophin positive cells in the hypothalamus, and decreased testes size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Sh2d3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Sh2d3c APN 2 32,615,096 (GRCm39) missense probably benign 0.00
IGL02326:Sh2d3c APN 2 32,639,163 (GRCm39) critical splice acceptor site probably null
IGL03325:Sh2d3c APN 2 32,615,270 (GRCm39) missense probably benign 0.00
R0008:Sh2d3c UTSW 2 32,643,033 (GRCm39) missense probably damaging 1.00
R0619:Sh2d3c UTSW 2 32,643,037 (GRCm39) missense probably damaging 1.00
R1138:Sh2d3c UTSW 2 32,639,417 (GRCm39) missense probably benign 0.00
R1984:Sh2d3c UTSW 2 32,639,256 (GRCm39) nonsense probably null
R3808:Sh2d3c UTSW 2 32,636,108 (GRCm39) missense probably damaging 1.00
R4399:Sh2d3c UTSW 2 32,636,172 (GRCm39) missense probably damaging 0.97
R4556:Sh2d3c UTSW 2 32,643,021 (GRCm39) missense possibly damaging 0.81
R4840:Sh2d3c UTSW 2 32,611,172 (GRCm39) start codon destroyed probably null 0.02
R5027:Sh2d3c UTSW 2 32,634,814 (GRCm39) missense possibly damaging 0.95
R5367:Sh2d3c UTSW 2 32,635,914 (GRCm39) missense probably damaging 1.00
R6754:Sh2d3c UTSW 2 32,644,542 (GRCm39) missense probably damaging 1.00
R6916:Sh2d3c UTSW 2 32,642,665 (GRCm39) nonsense probably null
R7029:Sh2d3c UTSW 2 32,644,581 (GRCm39) makesense probably null
R7047:Sh2d3c UTSW 2 32,611,172 (GRCm39) start codon destroyed probably null 0.02
R7636:Sh2d3c UTSW 2 32,615,023 (GRCm39) missense probably benign 0.17
R7893:Sh2d3c UTSW 2 32,639,388 (GRCm39) nonsense probably null
R8072:Sh2d3c UTSW 2 32,643,150 (GRCm39) missense probably damaging 1.00
R8115:Sh2d3c UTSW 2 32,615,276 (GRCm39) missense probably benign 0.12
R8447:Sh2d3c UTSW 2 32,642,671 (GRCm39) missense probably damaging 1.00
R8553:Sh2d3c UTSW 2 32,635,925 (GRCm39) missense probably damaging 1.00
R9133:Sh2d3c UTSW 2 32,634,778 (GRCm39) missense possibly damaging 0.46
R9475:Sh2d3c UTSW 2 32,643,039 (GRCm39) missense probably damaging 1.00
R9710:Sh2d3c UTSW 2 32,635,889 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTTTCCTCAAGAGCCTGAAC -3'
(R):5'- AGCTACTCACCTTGCAGCTTGACC -3'

Sequencing Primer
(F):5'- CTATGGGTTCCCAAAGACTTCTGAG -3'
(R):5'- TGCAGCTTGACCTCAGC -3'
Posted On 2013-06-11