Incidental Mutation 'R5944:Krt36'
ID460486
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Namekeratin 36
SynonymsKrt1-22, keratin 5, HRa-1, Krt1-5
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5944 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100102007-100105626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100105313 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 95 (A95E)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
Predicted Effect probably benign
Transcript: ENSMUST00000107416
AA Change: A95E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: A95E

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127883
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 100102948 missense probably damaging 0.98
IGL01737:Krt36 APN 11 100104120 missense possibly damaging 0.62
IGL02388:Krt36 APN 11 100105164 nonsense probably null
IGL02985:Krt36 APN 11 100103179 missense probably benign 0.32
R0393:Krt36 UTSW 11 100104114 missense possibly damaging 0.91
R0617:Krt36 UTSW 11 100102275 missense probably damaging 1.00
R0930:Krt36 UTSW 11 100103399 missense probably damaging 1.00
R1166:Krt36 UTSW 11 100102828 missense probably benign 0.00
R1201:Krt36 UTSW 11 100104057 missense probably benign 0.22
R1587:Krt36 UTSW 11 100102302 missense probably damaging 1.00
R1750:Krt36 UTSW 11 100104058 missense probably benign 0.00
R1826:Krt36 UTSW 11 100103030 splice site probably benign
R1846:Krt36 UTSW 11 100105548 missense probably damaging 1.00
R2208:Krt36 UTSW 11 100102939 missense probably damaging 0.96
R4303:Krt36 UTSW 11 100103413 missense possibly damaging 0.59
R5140:Krt36 UTSW 11 100103502 missense probably damaging 1.00
R5719:Krt36 UTSW 11 100104161 missense possibly damaging 0.95
R6188:Krt36 UTSW 11 100102420 missense probably benign 0.00
R6271:Krt36 UTSW 11 100104472 nonsense probably null
R6809:Krt36 UTSW 11 100105509 missense probably benign 0.00
R6856:Krt36 UTSW 11 100103390 missense probably damaging 1.00
R7153:Krt36 UTSW 11 100105146 nonsense probably null
R7602:Krt36 UTSW 11 100102960 missense probably benign 0.00
R7822:Krt36 UTSW 11 100104140 missense possibly damaging 0.86
R7894:Krt36 UTSW 11 100105235 missense probably damaging 1.00
R7977:Krt36 UTSW 11 100105235 missense probably damaging 1.00
Z1088:Krt36 UTSW 11 100104189 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGACCTGGCCTATTACCTTCTG -3'
(R):5'- AGGGAGCTTCTCTCGGATATC -3'

Sequencing Primer
(F):5'- TGCTGCAACTCCTCAGCAG -3'
(R):5'- ATTCCATGGGCTCCTGCAG -3'
Posted On2017-02-28