Incidental Mutation 'R5944:Stat3'
ID460488
Institutional Source Beutler Lab
Gene Symbol Stat3
Ensembl Gene ENSMUSG00000004040
Gene Namesignal transducer and activator of transcription 3
Synonyms1110034C02Rik, Aprf
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5944 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100885098-100939540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100895105 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 449 (A449T)
Ref Sequence ENSEMBL: ENSMUSP00000121677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000127638] [ENSMUST00000138438]
Predicted Effect probably damaging
Transcript: ENSMUST00000092671
AA Change: A475T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040
AA Change: A475T

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 2.2e-62 PFAM
Pfam:STAT_bind 321 574 1.8e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103114
AA Change: A475T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040
AA Change: A475T

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127638
AA Change: A475T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040
AA Change: A475T

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137367
Predicted Effect probably damaging
Transcript: ENSMUST00000138438
AA Change: A449T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040
AA Change: A449T

DomainStartEndE-ValueType
STAT_int 2 123 5.47e-35 SMART
coiled coil region 171 195 N/A INTRINSIC
coiled coil region 243 265 N/A INTRINSIC
Pfam:STAT_bind 295 548 9.2e-131 PFAM
SH2 556 637 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156645
Meta Mutation Damage Score 0.9425 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 6.5-7.5. Conditional, tissue specific mutants are variably viable and show diverse defects including obesity, diabetes, thermal dysregulation and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Stat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Stat3 APN 11 100903658 missense possibly damaging 0.77
IGL02289:Stat3 APN 11 100905894 missense possibly damaging 0.82
IGL03183:Stat3 APN 11 100902756 missense possibly damaging 0.71
Cunegonde UTSW 11 100898633 missense probably damaging 0.99
monostatos UTSW 11 100895105 missense probably damaging 1.00
Pangloss UTSW 11 100893670 missense possibly damaging 0.92
Stamatios UTSW 11 100893230 missense probably damaging 1.00
Voltaire UTSW 11 100911267 missense probably damaging 0.99
R0143:Stat3 UTSW 11 100895156 missense possibly damaging 0.89
R0395:Stat3 UTSW 11 100889937 splice site probably benign
R0487:Stat3 UTSW 11 100903643 missense probably damaging 1.00
R0589:Stat3 UTSW 11 100908083 missense probably damaging 0.97
R0800:Stat3 UTSW 11 100894155 splice site probably benign
R1393:Stat3 UTSW 11 100888765 splice site probably null
R1927:Stat3 UTSW 11 100894829 missense probably damaging 1.00
R3819:Stat3 UTSW 11 100898633 missense probably damaging 0.99
R4037:Stat3 UTSW 11 100893125 missense probably damaging 1.00
R4391:Stat3 UTSW 11 100905552 intron probably benign
R4598:Stat3 UTSW 11 100903674 missense probably damaging 1.00
R4637:Stat3 UTSW 11 100893230 missense probably damaging 1.00
R5479:Stat3 UTSW 11 100889888 unclassified probably benign
R5909:Stat3 UTSW 11 100903730 missense probably benign 0.00
R5930:Stat3 UTSW 11 100893670 missense possibly damaging 0.92
R6002:Stat3 UTSW 11 100903743 missense probably benign 0.01
R6431:Stat3 UTSW 11 100889574 missense possibly damaging 0.79
R6816:Stat3 UTSW 11 100911267 missense probably damaging 0.99
R8071:Stat3 UTSW 11 100893981 missense probably benign
R8466:Stat3 UTSW 11 100895098 missense probably damaging 1.00
X0033:Stat3 UTSW 11 100893092 missense probably benign
Z1176:Stat3 UTSW 11 100911278 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTTGGATGAGAGAGTGACAC -3'
(R):5'- ATGCAGGCTGGTCTTTCTCC -3'

Sequencing Primer
(F):5'- AGAGTGACACTGACAGCCTGC -3'
(R):5'- GCTCCAGCCTGCACTTG -3'
Posted On2017-02-28