Incidental Mutation 'R0564:Pdk1'
ID 46049
Institutional Source Beutler Lab
Gene Symbol Pdk1
Ensembl Gene ENSMUSG00000006494
Gene Name pyruvate dehydrogenase kinase, isoenzyme 1
Synonyms D530020C15Rik
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0564 (G1)
Quality Score 164
Status Validated
Chromosome 2
Chromosomal Location 71703568-71734202 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 71710383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 113 (W113*)
Ref Sequence ENSEMBL: ENSMUSP00000006669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006669]
AlphaFold Q8BFP9
Predicted Effect probably null
Transcript: ENSMUST00000006669
AA Change: W113*
SMART Domains Protein: ENSMUSP00000006669
Gene: ENSMUSG00000006494
AA Change: W113*

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Pfam:BCDHK_Adom3 56 218 6.4e-52 PFAM
HATPase_c 266 391 1.82e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156036
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Pdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pdk1 APN 2 71,726,123 (GRCm39) missense probably benign 0.00
IGL01643:Pdk1 APN 2 71,728,049 (GRCm39) missense probably damaging 1.00
IGL02672:Pdk1 APN 2 71,726,096 (GRCm39) missense probably damaging 1.00
IGL02833:Pdk1 APN 2 71,727,989 (GRCm39) critical splice acceptor site probably null
IGL03271:Pdk1 APN 2 71,710,374 (GRCm39) splice site probably benign
IGL03400:Pdk1 APN 2 71,726,091 (GRCm39) missense probably benign 0.25
R0329:Pdk1 UTSW 2 71,726,018 (GRCm39) splice site probably benign
R1653:Pdk1 UTSW 2 71,719,339 (GRCm39) critical splice donor site probably null
R2570:Pdk1 UTSW 2 71,703,904 (GRCm39) missense possibly damaging 0.56
R5137:Pdk1 UTSW 2 71,713,913 (GRCm39) missense possibly damaging 0.90
R5932:Pdk1 UTSW 2 71,713,760 (GRCm39) splice site probably null
R6109:Pdk1 UTSW 2 71,713,850 (GRCm39) missense probably benign 0.23
R7107:Pdk1 UTSW 2 71,726,085 (GRCm39) missense probably benign 0.00
R7227:Pdk1 UTSW 2 71,714,245 (GRCm39) missense possibly damaging 0.75
R7663:Pdk1 UTSW 2 71,705,742 (GRCm39) splice site probably null
R8011:Pdk1 UTSW 2 71,705,796 (GRCm39) missense probably benign 0.05
R9178:Pdk1 UTSW 2 71,730,402 (GRCm39) missense probably benign 0.00
RF020:Pdk1 UTSW 2 71,714,240 (GRCm39) missense possibly damaging 0.84
RF060:Pdk1 UTSW 2 71,703,789 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGTGTAAAATTCCTATTTGAGGGCCAGT -3'
(R):5'- CAGTAGAGAGGGCAGTGTAGCGT -3'

Sequencing Primer
(F):5'- tgcacaaagcccagatcac -3'
(R):5'- AATAGTTTTAGCATCTTCAGCACTT -3'
Posted On 2013-06-11